Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627443_at:

>probe:Drosophila_2:1627443_at:189:287; Interrogation_Position=1010; Antisense; CTGTGACTCCTTTTGTTTATTGATT
>probe:Drosophila_2:1627443_at:507:357; Interrogation_Position=1045; Antisense; GCAACGAAACAAGGCCTGTAGCTTA
>probe:Drosophila_2:1627443_at:632:267; Interrogation_Position=1078; Antisense; CAGGGCTGCGAACAACTCATACAAA
>probe:Drosophila_2:1627443_at:193:213; Interrogation_Position=1109; Antisense; AAGGTTATAGTTGATATCCGGGCAC
>probe:Drosophila_2:1627443_at:424:47; Interrogation_Position=1124; Antisense; ATCCGGGCACTTGTGAATACACGAA
>probe:Drosophila_2:1627443_at:622:355; Interrogation_Position=667; Antisense; GCACTTTTTAGTCTTCTATGTCATG
>probe:Drosophila_2:1627443_at:640:457; Interrogation_Position=711; Antisense; GATATACGCAACTGAGTCCTGATTA
>probe:Drosophila_2:1627443_at:159:245; Interrogation_Position=795; Antisense; AATTAATGGCATTTCAAGCGAGCAG
>probe:Drosophila_2:1627443_at:677:201; Interrogation_Position=853; Antisense; AACCAACCACCTGTGGAGACCAGTG
>probe:Drosophila_2:1627443_at:110:515; Interrogation_Position=891; Antisense; GTGTCCAGTGGATCTAAATTTGAGC
>probe:Drosophila_2:1627443_at:441:691; Interrogation_Position=909; Antisense; TTTGAGCATTTTAATCGGATTCGGC
>probe:Drosophila_2:1627443_at:57:151; Interrogation_Position=946; Antisense; ACATTGAGTCTTCTGTTTGGCGGTC
>probe:Drosophila_2:1627443_at:182:291; Interrogation_Position=966; Antisense; CGGTCTTCATTCTGTTAGCTCTTAT
>probe:Drosophila_2:1627443_at:417:511; Interrogation_Position=998; Antisense; GTGACTGAATAACTGTGACTCCTTT

Paste this into a BLAST search page for me
CTGTGACTCCTTTTGTTTATTGATTGCAACGAAACAAGGCCTGTAGCTTACAGGGCTGCGAACAACTCATACAAAAAGGTTATAGTTGATATCCGGGCACATCCGGGCACTTGTGAATACACGAAGCACTTTTTAGTCTTCTATGTCATGGATATACGCAACTGAGTCCTGATTAAATTAATGGCATTTCAAGCGAGCAGAACCAACCACCTGTGGAGACCAGTGGTGTCCAGTGGATCTAAATTTGAGCTTTGAGCATTTTAATCGGATTCGGCACATTGAGTCTTCTGTTTGGCGGTCCGGTCTTCATTCTGTTAGCTCTTATGTGACTGAATAACTGTGACTCCTTT

Full Affymetrix probeset data:

Annotations for 1627443_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime