FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627444_at:

>probe:Drosophila_2:1627444_at:201:215; Interrogation_Position=1172; Antisense; AAGGCTTTCAGGATCCCAATTGGAT
>probe:Drosophila_2:1627444_at:70:529; Interrogation_Position=1233; Antisense; GGGATTGGTCCTGGCAAACTGCTAC
>probe:Drosophila_2:1627444_at:642:95; Interrogation_Position=1271; Antisense; AGATTAGCCGGCTCTTGTTTCCAAG
>probe:Drosophila_2:1627444_at:539:457; Interrogation_Position=1354; Antisense; GATATGGTGCGAATGTGTCCCGGTC
>probe:Drosophila_2:1627444_at:192:597; Interrogation_Position=1367; Antisense; TGTGTCCCGGTCTCAACGATATCTA
>probe:Drosophila_2:1627444_at:184:139; Interrogation_Position=1382; Antisense; ACGATATCTACTTGCTGGACTGTCC
>probe:Drosophila_2:1627444_at:358:587; Interrogation_Position=1397; Antisense; TGGACTGTCCCCAGTTGAGCTGGAA
>probe:Drosophila_2:1627444_at:528:387; Interrogation_Position=1456; Antisense; GAAAATCTTAGCTATCCCATTACCA
>probe:Drosophila_2:1627444_at:180:11; Interrogation_Position=1474; Antisense; ATTACCATTATCCTCAGTCAACACT
>probe:Drosophila_2:1627444_at:24:187; Interrogation_Position=1493; Antisense; AACACTCTGAACTCAGGGATGCCTA
>probe:Drosophila_2:1627444_at:99:449; Interrogation_Position=1510; Antisense; GATGCCTATCAGTCCATGTACTCAA
>probe:Drosophila_2:1627444_at:422:269; Interrogation_Position=1524; Antisense; CATGTACTCAAACTTCTGGTGCTTC
>probe:Drosophila_2:1627444_at:675:203; Interrogation_Position=1549; Antisense; AAGCTCCCTTTCCTCAGAATGGAAC
>probe:Drosophila_2:1627444_at:374:329; Interrogation_Position=1574; Antisense; GCGTAATTCATCAATGTCGACCGAT

Paste this into a BLAST search page for me
AAGGCTTTCAGGATCCCAATTGGATGGGATTGGTCCTGGCAAACTGCTACAGATTAGCCGGCTCTTGTTTCCAAGGATATGGTGCGAATGTGTCCCGGTCTGTGTCCCGGTCTCAACGATATCTAACGATATCTACTTGCTGGACTGTCCTGGACTGTCCCCAGTTGAGCTGGAAGAAAATCTTAGCTATCCCATTACCAATTACCATTATCCTCAGTCAACACTAACACTCTGAACTCAGGGATGCCTAGATGCCTATCAGTCCATGTACTCAACATGTACTCAAACTTCTGGTGCTTCAAGCTCCCTTTCCTCAGAATGGAACGCGTAATTCATCAATGTCGACCGAT

Full Affymetrix probeset data:

Annotations for 1627444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720