FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627446_at:

>probe:Drosophila_2:1627446_at:13:485; Interrogation_Position=1603; Antisense; GTATGCCTGCATACAATTTGTATTT
>probe:Drosophila_2:1627446_at:173:35; Interrogation_Position=1665; Antisense; ATCATAATTTAATCTCTACCTACAG
>probe:Drosophila_2:1627446_at:128:497; Interrogation_Position=1700; Antisense; GTCAGTACAAAAAGTCAACGCCATC
>probe:Drosophila_2:1627446_at:325:495; Interrogation_Position=1713; Antisense; GTCAACGCCATCTATGTACGAGTGT
>probe:Drosophila_2:1627446_at:721:237; Interrogation_Position=1751; Antisense; AATCGGCATCCTTAAAACCTATGTA
>probe:Drosophila_2:1627446_at:152:477; Interrogation_Position=1813; Antisense; GTTTCAGTTTCTTGTTTCAAACAGG
>probe:Drosophila_2:1627446_at:85:725; Interrogation_Position=1885; Antisense; TTGTAATTTCACCATCAACTTTAGT
>probe:Drosophila_2:1627446_at:708:649; Interrogation_Position=1899; Antisense; TCAACTTTAGTTACCTTAGGACTGA
>probe:Drosophila_2:1627446_at:366:645; Interrogation_Position=1972; Antisense; TCTTCTTTTACGAATTGCATACAAC
>probe:Drosophila_2:1627446_at:661:491; Interrogation_Position=2073; Antisense; GTAACTGTAGACGTTTCCTCTTCAA
>probe:Drosophila_2:1627446_at:77:695; Interrogation_Position=2086; Antisense; TTTCCTCTTCAATTGTAATCTCATT
>probe:Drosophila_2:1627446_at:122:275; Interrogation_Position=2121; Antisense; CATTGATATATTTGTACCCATGTAT
>probe:Drosophila_2:1627446_at:357:487; Interrogation_Position=2134; Antisense; GTACCCATGTATACATTCATAAGTG
>probe:Drosophila_2:1627446_at:96:33; Interrogation_Position=2152; Antisense; ATAAGTGTACGTGCCATAGAATCAG

Paste this into a BLAST search page for me
GTATGCCTGCATACAATTTGTATTTATCATAATTTAATCTCTACCTACAGGTCAGTACAAAAAGTCAACGCCATCGTCAACGCCATCTATGTACGAGTGTAATCGGCATCCTTAAAACCTATGTAGTTTCAGTTTCTTGTTTCAAACAGGTTGTAATTTCACCATCAACTTTAGTTCAACTTTAGTTACCTTAGGACTGATCTTCTTTTACGAATTGCATACAACGTAACTGTAGACGTTTCCTCTTCAATTTCCTCTTCAATTGTAATCTCATTCATTGATATATTTGTACCCATGTATGTACCCATGTATACATTCATAAGTGATAAGTGTACGTGCCATAGAATCAG

Full Affymetrix probeset data:

Annotations for 1627446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720