Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627447_at:

>probe:Drosophila_2:1627447_at:127:277; Interrogation_Position=123; Antisense; GCCCGTAAAGCTCCAGGACCGTAAG
>probe:Drosophila_2:1627447_at:346:555; Interrogation_Position=138; Antisense; GGACCGTAAGAGTTCATGGACCGAT
>probe:Drosophila_2:1627447_at:214:585; Interrogation_Position=154; Antisense; TGGACCGATCTAAAAAGGCCGCCCT
>probe:Drosophila_2:1627447_at:212:621; Interrogation_Position=182; Antisense; TGCTGGTCAAGAGCTTCCTCAACTT
>probe:Drosophila_2:1627447_at:388:559; Interrogation_Position=215; Antisense; TGGACGCCGACTACGGGAAGGACAT
>probe:Drosophila_2:1627447_at:714:51; Interrogation_Position=238; Antisense; ATGACACGAGTTACGGACGAGCTAA
>probe:Drosophila_2:1627447_at:340:669; Interrogation_Position=249; Antisense; TACGGACGAGCTAAGTTTCCAGCCC
>probe:Drosophila_2:1627447_at:255:653; Interrogation_Position=287; Antisense; TAATCAATACCGTGCGAGGGCCGCA
>probe:Drosophila_2:1627447_at:144:347; Interrogation_Position=309; Antisense; GCATCGTCAGTTTTCGGACACGGAA
>probe:Drosophila_2:1627447_at:669:557; Interrogation_Position=324; Antisense; GGACACGGAACCAATTGCGGACATG
>probe:Drosophila_2:1627447_at:3:503; Interrogation_Position=359; Antisense; GTCCGGTAGCTTTGGACTCGGATTC
>probe:Drosophila_2:1627447_at:291:531; Interrogation_Position=37; Antisense; GGGTCCCCGATATTCGAGGCTAAGA
>probe:Drosophila_2:1627447_at:27:623; Interrogation_Position=62; Antisense; TGCGGCTACAGCAGAGGCGACGAAT
>probe:Drosophila_2:1627447_at:79:369; Interrogation_Position=83; Antisense; GAATGTCAGAGCACAGGCTTCCGTA

Paste this into a BLAST search page for me
GCCCGTAAAGCTCCAGGACCGTAAGGGACCGTAAGAGTTCATGGACCGATTGGACCGATCTAAAAAGGCCGCCCTTGCTGGTCAAGAGCTTCCTCAACTTTGGACGCCGACTACGGGAAGGACATATGACACGAGTTACGGACGAGCTAATACGGACGAGCTAAGTTTCCAGCCCTAATCAATACCGTGCGAGGGCCGCAGCATCGTCAGTTTTCGGACACGGAAGGACACGGAACCAATTGCGGACATGGTCCGGTAGCTTTGGACTCGGATTCGGGTCCCCGATATTCGAGGCTAAGATGCGGCTACAGCAGAGGCGACGAATGAATGTCAGAGCACAGGCTTCCGTA

Full Affymetrix probeset data:

Annotations for 1627447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime