FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627448_at:

>probe:Drosophila_2:1627448_at:63:547; Interrogation_Position=1032; Antisense; GGATCCTCAGGACATGTACCGCGAT
>probe:Drosophila_2:1627448_at:322:449; Interrogation_Position=1054; Antisense; GATCCTGATGAGCTGCGCAACCTGA
>probe:Drosophila_2:1627448_at:687:159; Interrogation_Position=1094; Antisense; ACAAGTTCGGCAAGTCGCGCTACAT
>probe:Drosophila_2:1627448_at:709:527; Interrogation_Position=1128; Antisense; GGGACATGGAATCACGCCTCAGACT
>probe:Drosophila_2:1627448_at:594:433; Interrogation_Position=1204; Antisense; GGTGTGCCTTTCACTAACCTTTAAT
>probe:Drosophila_2:1627448_at:553:411; Interrogation_Position=702; Antisense; GACCGACGCAATTGTGGACTACCTG
>probe:Drosophila_2:1627448_at:521:605; Interrogation_Position=755; Antisense; TGCTGCAGGTATTCGAATCGTCCGC
>probe:Drosophila_2:1627448_at:171:115; Interrogation_Position=797; Antisense; AGCAGTTCCTGCAGTGGTGTGTACC
>probe:Drosophila_2:1627448_at:387:533; Interrogation_Position=812; Antisense; GGTGTGTACCCTACCTGAAGAGAAT
>probe:Drosophila_2:1627448_at:539:119; Interrogation_Position=845; Antisense; AGCTGGTGGACCGTCTCACAAAGAA
>probe:Drosophila_2:1627448_at:455:269; Interrogation_Position=888; Antisense; CATGACGCTGTTCGCTAAGGGTGCT
>probe:Drosophila_2:1627448_at:522:519; Interrogation_Position=942; Antisense; GGGCTACGACGTTATTGGCTTGGAT
>probe:Drosophila_2:1627448_at:577:431; Interrogation_Position=985; Antisense; GAGGCACGCAATTTGGTCGGACCGA
>probe:Drosophila_2:1627448_at:606:533; Interrogation_Position=999; Antisense; GGTCGGACCGAACATTACGTTGCAA

Paste this into a BLAST search page for me
GGATCCTCAGGACATGTACCGCGATGATCCTGATGAGCTGCGCAACCTGAACAAGTTCGGCAAGTCGCGCTACATGGGACATGGAATCACGCCTCAGACTGGTGTGCCTTTCACTAACCTTTAATGACCGACGCAATTGTGGACTACCTGTGCTGCAGGTATTCGAATCGTCCGCAGCAGTTCCTGCAGTGGTGTGTACCGGTGTGTACCCTACCTGAAGAGAATAGCTGGTGGACCGTCTCACAAAGAACATGACGCTGTTCGCTAAGGGTGCTGGGCTACGACGTTATTGGCTTGGATGAGGCACGCAATTTGGTCGGACCGAGGTCGGACCGAACATTACGTTGCAA

Full Affymetrix probeset data:

Annotations for 1627448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720