FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627449_at:

>probe:Drosophila_2:1627449_at:245:669; Interrogation_Position=1018; Antisense; TACGGGTGCCGCTATTGGTGGCCTT
>probe:Drosophila_2:1627449_at:697:539; Interrogation_Position=1064; Antisense; GGTTACGGGCAACCTACTCATCGCA
>probe:Drosophila_2:1627449_at:477:669; Interrogation_Position=1078; Antisense; TACTCATCGCATTTTCGCTAGCTCT
>probe:Drosophila_2:1627449_at:199:611; Interrogation_Position=1102; Antisense; TGACCATTGCGGCAGTCGCCTGGAT
>probe:Drosophila_2:1627449_at:683:545; Interrogation_Position=1123; Antisense; GGATCCTGCATCGTCCTGTGATCGG
>probe:Drosophila_2:1627449_at:197:541; Interrogation_Position=1186; Antisense; GGTTCACCCGCAATCTGGTCGACTA
>probe:Drosophila_2:1627449_at:439:269; Interrogation_Position=1212; Antisense; CATCGCCTGGACTAATCCATTTCAG
>probe:Drosophila_2:1627449_at:232:727; Interrogation_Position=1295; Antisense; TTGATCGCATTTGCCATTTATCCCT
>probe:Drosophila_2:1627449_at:160:359; Interrogation_Position=820; Antisense; GCAACAAACTGGTGCCGTACATAAC
>probe:Drosophila_2:1627449_at:224:581; Interrogation_Position=851; Antisense; TGGCGTTCCAGTGCTGCTCGTCTAT
>probe:Drosophila_2:1627449_at:518:637; Interrogation_Position=868; Antisense; TCGTCTATCCGGGTGGGCTCAGTGT
>probe:Drosophila_2:1627449_at:533:601; Interrogation_Position=901; Antisense; TGTTCCGGTTGGAGGCTCGTGCCCA
>probe:Drosophila_2:1627449_at:89:581; Interrogation_Position=960; Antisense; TGGCTGCTGATCTTCTTCGGCGTCA
>probe:Drosophila_2:1627449_at:617:183; Interrogation_Position=996; Antisense; AAAATCCTTCGTCTGCTGTTTGTAC

Paste this into a BLAST search page for me
TACGGGTGCCGCTATTGGTGGCCTTGGTTACGGGCAACCTACTCATCGCATACTCATCGCATTTTCGCTAGCTCTTGACCATTGCGGCAGTCGCCTGGATGGATCCTGCATCGTCCTGTGATCGGGGTTCACCCGCAATCTGGTCGACTACATCGCCTGGACTAATCCATTTCAGTTGATCGCATTTGCCATTTATCCCTGCAACAAACTGGTGCCGTACATAACTGGCGTTCCAGTGCTGCTCGTCTATTCGTCTATCCGGGTGGGCTCAGTGTTGTTCCGGTTGGAGGCTCGTGCCCATGGCTGCTGATCTTCTTCGGCGTCAAAAATCCTTCGTCTGCTGTTTGTAC

Full Affymetrix probeset data:

Annotations for 1627449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720