Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627450_at:

>probe:Drosophila_2:1627450_at:321:633; Interrogation_Position=19; Antisense; TCGCCAATATGCTTGCCACGATCGT
>probe:Drosophila_2:1627450_at:178:243; Interrogation_Position=24; Antisense; AATATGCTTGCCACGATCGTCGACG
>probe:Drosophila_2:1627450_at:178:53; Interrogation_Position=27; Antisense; ATGCTTGCCACGATCGTCGACGGTG
>probe:Drosophila_2:1627450_at:461:719; Interrogation_Position=31; Antisense; TTGCCACGATCGTCGACGGTGATGC
>probe:Drosophila_2:1627450_at:120:1; Interrogation_Position=344; Antisense; CCGTAGTCGGTAGTAGCGTGGTCCA
>probe:Drosophila_2:1627450_at:609:647; Interrogation_Position=347; Antisense; TAGTCGGTAGTAGCGTGGTCCACGC
>probe:Drosophila_2:1627450_at:309:499; Interrogation_Position=349; Antisense; GTCGGTAGTAGCGTGGTCCACGCCC
>probe:Drosophila_2:1627450_at:128:451; Interrogation_Position=38; Antisense; GATCGTCGACGGTGATGCTGGCCCT
>probe:Drosophila_2:1627450_at:539:501; Interrogation_Position=42; Antisense; GTCGACGGTGATGCTGGCCCTCTAT
>probe:Drosophila_2:1627450_at:28:409; Interrogation_Position=45; Antisense; GACGGTGATGCTGGCCCTCTATCAA
>probe:Drosophila_2:1627450_at:559:605; Interrogation_Position=50; Antisense; TGATGCTGGCCCTCTATCAACAATT
>probe:Drosophila_2:1627450_at:686:287; Interrogation_Position=55; Antisense; CTGGCCCTCTATCAACAATTCAAAT
>probe:Drosophila_2:1627450_at:527:577; Interrogation_Position=57; Antisense; GGCCCTCTATCAACAATTCAAATCT
>probe:Drosophila_2:1627450_at:33:685; Interrogation_Position=64; Antisense; TATCAACAATTCAAATCTGCTGGCC

Paste this into a BLAST search page for me
TCGCCAATATGCTTGCCACGATCGTAATATGCTTGCCACGATCGTCGACGATGCTTGCCACGATCGTCGACGGTGTTGCCACGATCGTCGACGGTGATGCCCGTAGTCGGTAGTAGCGTGGTCCATAGTCGGTAGTAGCGTGGTCCACGCGTCGGTAGTAGCGTGGTCCACGCCCGATCGTCGACGGTGATGCTGGCCCTGTCGACGGTGATGCTGGCCCTCTATGACGGTGATGCTGGCCCTCTATCAATGATGCTGGCCCTCTATCAACAATTCTGGCCCTCTATCAACAATTCAAATGGCCCTCTATCAACAATTCAAATCTTATCAACAATTCAAATCTGCTGGCC

Full Affymetrix probeset data:

Annotations for 1627450_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime