Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627455_at:

>probe:Drosophila_2:1627455_at:453:537; Interrogation_Position=2129; Antisense; GGTACCTTGCGATTGTGGGACATCA
>probe:Drosophila_2:1627455_at:203:391; Interrogation_Position=2155; Antisense; GAAACTATCGCCCATGAGTGACAAC
>probe:Drosophila_2:1627455_at:702:397; Interrogation_Position=2174; Antisense; GACAACAGTAGTGCTGGAAGCTCAT
>probe:Drosophila_2:1627455_at:86:253; Interrogation_Position=2208; Antisense; CAACGAATCGTGTGCTTACTGTCAA
>probe:Drosophila_2:1627455_at:670:707; Interrogation_Position=2223; Antisense; TTACTGTCAATAGTTCCTGCCAGCG
>probe:Drosophila_2:1627455_at:654:309; Interrogation_Position=2242; Antisense; CCAGCGCTTGGTCGATGTTTTTTAC
>probe:Drosophila_2:1627455_at:149:699; Interrogation_Position=2262; Antisense; TTTACGGGACCAGCAAGACGCTCTA
>probe:Drosophila_2:1627455_at:287:339; Interrogation_Position=2281; Antisense; GCTCTACTGCATCGGCACTTAAAGA
>probe:Drosophila_2:1627455_at:60:361; Interrogation_Position=2304; Antisense; GAAGACGGTTGAAAGTTCAGCCCGA
>probe:Drosophila_2:1627455_at:610:473; Interrogation_Position=2318; Antisense; GTTCAGCCCGAATTTAGACTTTCTA
>probe:Drosophila_2:1627455_at:515:403; Interrogation_Position=2334; Antisense; GACTTTCTAGTGACGACTTATGTTT
>probe:Drosophila_2:1627455_at:322:161; Interrogation_Position=2444; Antisense; ACAATCCTGGTAGCTTTCTTGTGGA
>probe:Drosophila_2:1627455_at:489:83; Interrogation_Position=2487; Antisense; AGTGTAATGCCTTTACCTGCATCGT
>probe:Drosophila_2:1627455_at:393:617; Interrogation_Position=2504; Antisense; TGCATCGTCTACTGGTCACAGCTAA

Paste this into a BLAST search page for me
GGTACCTTGCGATTGTGGGACATCAGAAACTATCGCCCATGAGTGACAACGACAACAGTAGTGCTGGAAGCTCATCAACGAATCGTGTGCTTACTGTCAATTACTGTCAATAGTTCCTGCCAGCGCCAGCGCTTGGTCGATGTTTTTTACTTTACGGGACCAGCAAGACGCTCTAGCTCTACTGCATCGGCACTTAAAGAGAAGACGGTTGAAAGTTCAGCCCGAGTTCAGCCCGAATTTAGACTTTCTAGACTTTCTAGTGACGACTTATGTTTACAATCCTGGTAGCTTTCTTGTGGAAGTGTAATGCCTTTACCTGCATCGTTGCATCGTCTACTGGTCACAGCTAA

Full Affymetrix probeset data:

Annotations for 1627455_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime