FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627457_at:

>probe:Drosophila_2:1627457_at:76:399; Interrogation_Position=1083; Antisense; GACAGGGCCACGGATCACGAAAGTT
>probe:Drosophila_2:1627457_at:371:691; Interrogation_Position=1139; Antisense; TTTGGACGGTATGGAGCACTCTCTG
>probe:Drosophila_2:1627457_at:158:613; Interrogation_Position=1162; Antisense; TGAACGGCGTTTTCGTCTTGGCCAG
>probe:Drosophila_2:1627457_at:626:5; Interrogation_Position=1206; Antisense; ATTGATGAGGCCTTTTTGCGGCGTT
>probe:Drosophila_2:1627457_at:401:171; Interrogation_Position=1235; Antisense; AAAGAAACTGCTTGTCCAGCTGCCC
>probe:Drosophila_2:1627457_at:413:601; Interrogation_Position=1282; Antisense; TGATTAACCGACTTTTGGGCAGCAG
>probe:Drosophila_2:1627457_at:352:23; Interrogation_Position=1308; Antisense; ATATCGCTGAATCCACGACTACTCG
>probe:Drosophila_2:1627457_at:95:97; Interrogation_Position=1345; Antisense; AGATCTCCGATCATTTTACCGGCGA
>probe:Drosophila_2:1627457_at:628:135; Interrogation_Position=1369; Antisense; ACGAAATACGTCTGGCTTGCAAGGA
>probe:Drosophila_2:1627457_at:661:41; Interrogation_Position=1405; Antisense; ATCGTGTGCGTTGTGCCACCAAGAT
>probe:Drosophila_2:1627457_at:685:453; Interrogation_Position=1438; Antisense; GATCAATCGGCTTGCTTGCTAAGGA
>probe:Drosophila_2:1627457_at:493:721; Interrogation_Position=1453; Antisense; TTGCTAAGGAATCGCCGGCAGCTAT
>probe:Drosophila_2:1627457_at:521:361; Interrogation_Position=1505; Antisense; GCAAGTGCGACCTTTGGGCCAGAAG
>probe:Drosophila_2:1627457_at:474:181; Interrogation_Position=1561; Antisense; AAAACGGCTCGTAGGCTGGAATCTC

Paste this into a BLAST search page for me
GACAGGGCCACGGATCACGAAAGTTTTTGGACGGTATGGAGCACTCTCTGTGAACGGCGTTTTCGTCTTGGCCAGATTGATGAGGCCTTTTTGCGGCGTTAAAGAAACTGCTTGTCCAGCTGCCCTGATTAACCGACTTTTGGGCAGCAGATATCGCTGAATCCACGACTACTCGAGATCTCCGATCATTTTACCGGCGAACGAAATACGTCTGGCTTGCAAGGAATCGTGTGCGTTGTGCCACCAAGATGATCAATCGGCTTGCTTGCTAAGGATTGCTAAGGAATCGCCGGCAGCTATGCAAGTGCGACCTTTGGGCCAGAAGAAAACGGCTCGTAGGCTGGAATCTC

Full Affymetrix probeset data:

Annotations for 1627457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720