FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627458_at:

>probe:Drosophila_2:1627458_at:544:621; Interrogation_Position=1269; Antisense; TGCTGCACGAAGTGCCCCATGAGAT
>probe:Drosophila_2:1627458_at:163:429; Interrogation_Position=1289; Antisense; GAGATTGGTGACTTTGCCATTCTTA
>probe:Drosophila_2:1627458_at:551:663; Interrogation_Position=1314; Antisense; TAAAGTCTGGCTGTTCCAGGCGAAA
>probe:Drosophila_2:1627458_at:708:393; Interrogation_Position=1335; Antisense; GAAAGGCAATGCTTCTGCAGCTCGT
>probe:Drosophila_2:1627458_at:83:567; Interrogation_Position=1382; Antisense; GGCACAGCGCTAGCTCTTCTGGGAG
>probe:Drosophila_2:1627458_at:704:257; Interrogation_Position=1447; Antisense; CACAGCCGGCGGTTTTATTTACATC
>probe:Drosophila_2:1627458_at:586:43; Interrogation_Position=1469; Antisense; ATCGCAACAGTGAGTGTCCTGCCGG
>probe:Drosophila_2:1627458_at:270:419; Interrogation_Position=1493; Antisense; GAGCTGCTTGAGGAGTCTACGAAAC
>probe:Drosophila_2:1627458_at:361:371; Interrogation_Position=1531; Antisense; GAAGGAAATCTTTGCGCTGCTAACC
>probe:Drosophila_2:1627458_at:415:575; Interrogation_Position=1556; Antisense; GGCGTAGCCCTAATGATCGTTATCG
>probe:Drosophila_2:1627458_at:463:451; Interrogation_Position=1570; Antisense; GATCGTTATCGCCAAGTTCGAGTAA
>probe:Drosophila_2:1627458_at:143:97; Interrogation_Position=1669; Antisense; AGATTTCTGTTCGTTACCTACTCAA
>probe:Drosophila_2:1627458_at:153:485; Interrogation_Position=1732; Antisense; GTCAGTAACCGCTATTAGTTCCCAA
>probe:Drosophila_2:1627458_at:22:315; Interrogation_Position=1791; Antisense; GCCTTCCAAATTTGTGCTTCACTTC

Paste this into a BLAST search page for me
TGCTGCACGAAGTGCCCCATGAGATGAGATTGGTGACTTTGCCATTCTTATAAAGTCTGGCTGTTCCAGGCGAAAGAAAGGCAATGCTTCTGCAGCTCGTGGCACAGCGCTAGCTCTTCTGGGAGCACAGCCGGCGGTTTTATTTACATCATCGCAACAGTGAGTGTCCTGCCGGGAGCTGCTTGAGGAGTCTACGAAACGAAGGAAATCTTTGCGCTGCTAACCGGCGTAGCCCTAATGATCGTTATCGGATCGTTATCGCCAAGTTCGAGTAAAGATTTCTGTTCGTTACCTACTCAAGTCAGTAACCGCTATTAGTTCCCAAGCCTTCCAAATTTGTGCTTCACTTC

Full Affymetrix probeset data:

Annotations for 1627458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720