Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627459_at:

>probe:Drosophila_2:1627459_at:255:213; Interrogation_Position=144; Antisense; AAGACCGGCAAGGATGCCCAGTTCG
>probe:Drosophila_2:1627459_at:151:431; Interrogation_Position=185; Antisense; GAGTCAGTTCTGGTACAGCACGGAA
>probe:Drosophila_2:1627459_at:517:59; Interrogation_Position=229; Antisense; ATGTTGTGCGTAAGCTTCTGGCGGA
>probe:Drosophila_2:1627459_at:525:403; Interrogation_Position=273; Antisense; GACTTTAGTATAGCACTGCTCTCCT
>probe:Drosophila_2:1627459_at:168:271; Interrogation_Position=301; Antisense; CATCGCTCTACAAGGACATCAGGGA
>probe:Drosophila_2:1627459_at:269:397; Interrogation_Position=333; Antisense; GACACAGTGCACATATTCGAGTTCG
>probe:Drosophila_2:1627459_at:484:159; Interrogation_Position=358; Antisense; ACAAGCGTTTCGAGGCCTATGGCAC
>probe:Drosophila_2:1627459_at:472:461; Interrogation_Position=384; Antisense; GATTTTGTGCACTACGACTTGAACT
>probe:Drosophila_2:1627459_at:67:195; Interrogation_Position=405; Antisense; AACTGCGTAGGGAGCAACCCGGACT
>probe:Drosophila_2:1627459_at:241:111; Interrogation_Position=448; Antisense; AGCAATATGACCTCATCGTGGCCGA
>probe:Drosophila_2:1627459_at:199:549; Interrogation_Position=491; Antisense; GGAGTGCATCGCCAAAACGTGTGAA
>probe:Drosophila_2:1627459_at:267:251; Interrogation_Position=551; Antisense; CAAGGTAATCCTGTGCTCCGGTGAG
>probe:Drosophila_2:1627459_at:299:359; Interrogation_Position=652; Antisense; GCAACAAGTTTGTCAGCTACGCCAA
>probe:Drosophila_2:1627459_at:91:495; Interrogation_Position=663; Antisense; GTCAGCTACGCCAACTTCAATTTAG

Paste this into a BLAST search page for me
AAGACCGGCAAGGATGCCCAGTTCGGAGTCAGTTCTGGTACAGCACGGAAATGTTGTGCGTAAGCTTCTGGCGGAGACTTTAGTATAGCACTGCTCTCCTCATCGCTCTACAAGGACATCAGGGAGACACAGTGCACATATTCGAGTTCGACAAGCGTTTCGAGGCCTATGGCACGATTTTGTGCACTACGACTTGAACTAACTGCGTAGGGAGCAACCCGGACTAGCAATATGACCTCATCGTGGCCGAGGAGTGCATCGCCAAAACGTGTGAACAAGGTAATCCTGTGCTCCGGTGAGGCAACAAGTTTGTCAGCTACGCCAAGTCAGCTACGCCAACTTCAATTTAG

Full Affymetrix probeset data:

Annotations for 1627459_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime