FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627460_at:

>probe:Drosophila_2:1627460_at:542:51; Interrogation_Position=131; Antisense; ATGCGGCACGCAGTTCCTTGAATGT
>probe:Drosophila_2:1627460_at:110:371; Interrogation_Position=150; Antisense; GAATGTGTCTACAGGAACGCGTCCA
>probe:Drosophila_2:1627460_at:127:201; Interrogation_Position=165; Antisense; AACGCGTCCATGTACTCTGTTCTGG
>probe:Drosophila_2:1627460_at:4:641; Interrogation_Position=180; Antisense; TCTGTTCTGGGCGATCTGATCACAT
>probe:Drosophila_2:1627460_at:19:599; Interrogation_Position=196; Antisense; TGATCACATACGTGGTGTTCCTGGG
>probe:Drosophila_2:1627460_at:66:395; Interrogation_Position=22; Antisense; GAAATGTCCCATTTGTCGGCTTATC
>probe:Drosophila_2:1627460_at:447:507; Interrogation_Position=227; Antisense; GTGCTACGCAATACTTTTCGGCTTC
>probe:Drosophila_2:1627460_at:202:407; Interrogation_Position=253; Antisense; GACTGTTGCTGTCCTGCGTGCGAAT
>probe:Drosophila_2:1627460_at:561:327; Interrogation_Position=268; Antisense; GCGTGCGAATCGTCCTCAAAGTGGT
>probe:Drosophila_2:1627460_at:666:649; Interrogation_Position=283; Antisense; TCAAAGTGGTTATCGCCCTCTTCGT
>probe:Drosophila_2:1627460_at:377:47; Interrogation_Position=309; Antisense; ATCCGATTGCTGCTAGCTTTGGGCT
>probe:Drosophila_2:1627460_at:320:151; Interrogation_Position=345; Antisense; ACATCTGTTAGCTATTCCGGGTGAA
>probe:Drosophila_2:1627460_at:189:641; Interrogation_Position=37; Antisense; TCGGCTTATCCAGCATATACGTCAG
>probe:Drosophila_2:1627460_at:458:237; Interrogation_Position=376; Antisense; AATCTGGCGAATGCCATCGGGACCA

Paste this into a BLAST search page for me
ATGCGGCACGCAGTTCCTTGAATGTGAATGTGTCTACAGGAACGCGTCCAAACGCGTCCATGTACTCTGTTCTGGTCTGTTCTGGGCGATCTGATCACATTGATCACATACGTGGTGTTCCTGGGGAAATGTCCCATTTGTCGGCTTATCGTGCTACGCAATACTTTTCGGCTTCGACTGTTGCTGTCCTGCGTGCGAATGCGTGCGAATCGTCCTCAAAGTGGTTCAAAGTGGTTATCGCCCTCTTCGTATCCGATTGCTGCTAGCTTTGGGCTACATCTGTTAGCTATTCCGGGTGAATCGGCTTATCCAGCATATACGTCAGAATCTGGCGAATGCCATCGGGACCA

Full Affymetrix probeset data:

Annotations for 1627460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720