Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627461_at:

>probe:Drosophila_2:1627461_at:315:309; Interrogation_Position=3893; Antisense; CCAGGAGGCGGCTTCTAAGGAGATT
>probe:Drosophila_2:1627461_at:466:593; Interrogation_Position=3918; Antisense; TGGGATAAGCACCTGTCCAATGCCC
>probe:Drosophila_2:1627461_at:435:231; Interrogation_Position=3936; Antisense; AATGCCCCAAGGCTGATGTTCCAGC
>probe:Drosophila_2:1627461_at:628:59; Interrogation_Position=3951; Antisense; ATGTTCCAGCGCGTTTTGCAGACGG
>probe:Drosophila_2:1627461_at:66:311; Interrogation_Position=4006; Antisense; CCACAGTCATTTCCCAGCTGAAGAA
>probe:Drosophila_2:1627461_at:530:155; Interrogation_Position=4030; Antisense; ACAGCAAAATCTCCGAGGGCGCGAT
>probe:Drosophila_2:1627461_at:591:367; Interrogation_Position=4080; Antisense; GACATCCAGACTACCAAGGGCAACT
>probe:Drosophila_2:1627461_at:159:527; Interrogation_Position=4097; Antisense; GGGCAACTCCGACAAGGCCATGGTT
>probe:Drosophila_2:1627461_at:176:315; Interrogation_Position=4113; Antisense; GCCATGGTTGTCTTGGCCAATGCCA
>probe:Drosophila_2:1627461_at:576:577; Interrogation_Position=4127; Antisense; GGCCAATGCCATTAAGGACGTATCC
>probe:Drosophila_2:1627461_at:102:401; Interrogation_Position=4169; Antisense; GACAGCTCTGCTGCGTCTGAAACAG
>probe:Drosophila_2:1627461_at:125:405; Interrogation_Position=4296; Antisense; GACGTGTCGCCATCGGTACCGGAAA
>probe:Drosophila_2:1627461_at:310:111; Interrogation_Position=4341; Antisense; AGCAAGGCCTAGAGGTTTCTGCAAA
>probe:Drosophila_2:1627461_at:406:275; Interrogation_Position=4371; Antisense; CTTGTTTAGTGTAGGCCGTCGTGAT

Paste this into a BLAST search page for me
CCAGGAGGCGGCTTCTAAGGAGATTTGGGATAAGCACCTGTCCAATGCCCAATGCCCCAAGGCTGATGTTCCAGCATGTTCCAGCGCGTTTTGCAGACGGCCACAGTCATTTCCCAGCTGAAGAAACAGCAAAATCTCCGAGGGCGCGATGACATCCAGACTACCAAGGGCAACTGGGCAACTCCGACAAGGCCATGGTTGCCATGGTTGTCTTGGCCAATGCCAGGCCAATGCCATTAAGGACGTATCCGACAGCTCTGCTGCGTCTGAAACAGGACGTGTCGCCATCGGTACCGGAAAAGCAAGGCCTAGAGGTTTCTGCAAACTTGTTTAGTGTAGGCCGTCGTGAT

Full Affymetrix probeset data:

Annotations for 1627461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime