FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627463_at:

>probe:Drosophila_2:1627463_at:260:729; Interrogation_Position=358; Antisense; TTGTCCTCTTTATCTTGAGCCATGG
>probe:Drosophila_2:1627463_at:662:725; Interrogation_Position=372; Antisense; TTGAGCCATGGCGACCGAAAAGAGA
>probe:Drosophila_2:1627463_at:657:387; Interrogation_Position=395; Antisense; GAAAATCTTGGCATGCGACCACAGG
>probe:Drosophila_2:1627463_at:79:327; Interrogation_Position=409; Antisense; GCGACCACAGGGAATACCACTTGGA
>probe:Drosophila_2:1627463_at:8:203; Interrogation_Position=462; Antisense; AATCCAACCTTATCTGGCAAGCCAA
>probe:Drosophila_2:1627463_at:198:5; Interrogation_Position=495; Antisense; ATTGTTCAAGCCTGCAAGGGTCCGT
>probe:Drosophila_2:1627463_at:717:535; Interrogation_Position=513; Antisense; GGTCCGTTGAGAGCTGACGCGAAAA
>probe:Drosophila_2:1627463_at:562:657; Interrogation_Position=560; Antisense; TAAGTGTTACAGCTGCTCCGAGGGC
>probe:Drosophila_2:1627463_at:168:83; Interrogation_Position=580; Antisense; AGGGCTATTTGAGCTATCGCAATGA
>probe:Drosophila_2:1627463_at:504:477; Interrogation_Position=618; Antisense; GTTTTCATACAAACCTTGTGCGAGG
>probe:Drosophila_2:1627463_at:672:433; Interrogation_Position=702; Antisense; GAGGTCGAACGAAGGTCAACTATGA
>probe:Drosophila_2:1627463_at:24:401; Interrogation_Position=725; Antisense; GACAGGTTCGAAACAAGTTCCTTCT
>probe:Drosophila_2:1627463_at:642:215; Interrogation_Position=739; Antisense; AAGTTCCTTCTGAGGAGTCGCACAA
>probe:Drosophila_2:1627463_at:110:17; Interrogation_Position=905; Antisense; ATTTACTTTCACTTTGTCAAACTGT

Paste this into a BLAST search page for me
TTGTCCTCTTTATCTTGAGCCATGGTTGAGCCATGGCGACCGAAAAGAGAGAAAATCTTGGCATGCGACCACAGGGCGACCACAGGGAATACCACTTGGAAATCCAACCTTATCTGGCAAGCCAAATTGTTCAAGCCTGCAAGGGTCCGTGGTCCGTTGAGAGCTGACGCGAAAATAAGTGTTACAGCTGCTCCGAGGGCAGGGCTATTTGAGCTATCGCAATGAGTTTTCATACAAACCTTGTGCGAGGGAGGTCGAACGAAGGTCAACTATGAGACAGGTTCGAAACAAGTTCCTTCTAAGTTCCTTCTGAGGAGTCGCACAAATTTACTTTCACTTTGTCAAACTGT

Full Affymetrix probeset data:

Annotations for 1627463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720