FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627464_at:

>probe:Drosophila_2:1627464_at:26:721; Interrogation_Position=1454; Antisense; TTCCGCCTTTCTTGCGTTCAAAGAG
>probe:Drosophila_2:1627464_at:659:433; Interrogation_Position=1483; Antisense; GAGGTTTCTCCTACGAGGCGGTGAC
>probe:Drosophila_2:1627464_at:689:77; Interrogation_Position=1513; Antisense; AGGTTCTACAGATCATTCGCACAAA
>probe:Drosophila_2:1627464_at:249:629; Interrogation_Position=1561; Antisense; TCCTGGTCAACATGGGCAACGGTAT
>probe:Drosophila_2:1627464_at:621:483; Interrogation_Position=1582; Antisense; GTATGGAAATCCTCGATGGGCTCGC
>probe:Drosophila_2:1627464_at:397:181; Interrogation_Position=1611; Antisense; AAAACCTACGAGTATGTGCTGGCCA
>probe:Drosophila_2:1627464_at:506:101; Interrogation_Position=1681; Antisense; AGAGAATCATTCTCATGCCCTACGA
>probe:Drosophila_2:1627464_at:628:49; Interrogation_Position=1695; Antisense; ATGCCCTACGAAGCAGTCGTTCTAC
>probe:Drosophila_2:1627464_at:485:3; Interrogation_Position=1709; Antisense; AGTCGTTCTACGCTGGTTGGCTTAA
>probe:Drosophila_2:1627464_at:208:539; Interrogation_Position=1723; Antisense; GGTTGGCTTAACTTCTTGTACTTAT
>probe:Drosophila_2:1627464_at:119:91; Interrogation_Position=1817; Antisense; AGATAGGCCCTGTTTCGACATATGT
>probe:Drosophila_2:1627464_at:671:367; Interrogation_Position=1871; Antisense; GAATGCCAATTACCACATCTAGATT
>probe:Drosophila_2:1627464_at:16:71; Interrogation_Position=1919; Antisense; AGGCATTTGGCCTGAGCTGTCGCTT
>probe:Drosophila_2:1627464_at:523:285; Interrogation_Position=1935; Antisense; CTGTCGCTTGGTTATCGCTATGGAT

Paste this into a BLAST search page for me
TTCCGCCTTTCTTGCGTTCAAAGAGGAGGTTTCTCCTACGAGGCGGTGACAGGTTCTACAGATCATTCGCACAAATCCTGGTCAACATGGGCAACGGTATGTATGGAAATCCTCGATGGGCTCGCAAAACCTACGAGTATGTGCTGGCCAAGAGAATCATTCTCATGCCCTACGAATGCCCTACGAAGCAGTCGTTCTACAGTCGTTCTACGCTGGTTGGCTTAAGGTTGGCTTAACTTCTTGTACTTATAGATAGGCCCTGTTTCGACATATGTGAATGCCAATTACCACATCTAGATTAGGCATTTGGCCTGAGCTGTCGCTTCTGTCGCTTGGTTATCGCTATGGAT

Full Affymetrix probeset data:

Annotations for 1627464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720