FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627465_at:

>probe:Drosophila_2:1627465_at:711:107; Interrogation_Position=111; Antisense; AGAAGAGCCTTTGGAAATCACCGAG
>probe:Drosophila_2:1627465_at:528:563; Interrogation_Position=135; Antisense; GGAATCGCCGGATAATCCTGAGGCA
>probe:Drosophila_2:1627465_at:298:185; Interrogation_Position=205; Antisense; AACAAGGCCCCTGCTGATAACGAAG
>probe:Drosophila_2:1627465_at:361:379; Interrogation_Position=226; Antisense; GAAGCCAAGATGACACAACTGCCGT
>probe:Drosophila_2:1627465_at:472:449; Interrogation_Position=280; Antisense; GATCCGGATCTGCATATGGCCAACA
>probe:Drosophila_2:1627465_at:730:57; Interrogation_Position=305; Antisense; ATGAGGCCGTGTTCATAGTGGCGAA
>probe:Drosophila_2:1627465_at:620:347; Interrogation_Position=331; Antisense; GCAGTGGAACTATTCATAGCCTCGT
>probe:Drosophila_2:1627465_at:379:27; Interrogation_Position=346; Antisense; ATAGCCTCGTTGTCACGGGAATCAT
>probe:Drosophila_2:1627465_at:312:527; Interrogation_Position=362; Antisense; GGGAATCATATACCTACACGGCGCA
>probe:Drosophila_2:1627465_at:487:457; Interrogation_Position=421; Antisense; GATATGGCCATTTCTGCTGTGGACA
>probe:Drosophila_2:1627465_at:474:399; Interrogation_Position=442; Antisense; GACAGTTTGCTATTCCTTGATGGAG
>probe:Drosophila_2:1627465_at:230:441; Interrogation_Position=460; Antisense; GATGGAGCCATGAACTTTTGAACAC
>probe:Drosophila_2:1627465_at:460:245; Interrogation_Position=554; Antisense; AATTCAGTTCTAAACGTCCTTATGG
>probe:Drosophila_2:1627465_at:92:75; Interrogation_Position=56; Antisense; AGGACTTGGAGCATCAGCAGGCCAT

Paste this into a BLAST search page for me
AGAAGAGCCTTTGGAAATCACCGAGGGAATCGCCGGATAATCCTGAGGCAAACAAGGCCCCTGCTGATAACGAAGGAAGCCAAGATGACACAACTGCCGTGATCCGGATCTGCATATGGCCAACAATGAGGCCGTGTTCATAGTGGCGAAGCAGTGGAACTATTCATAGCCTCGTATAGCCTCGTTGTCACGGGAATCATGGGAATCATATACCTACACGGCGCAGATATGGCCATTTCTGCTGTGGACAGACAGTTTGCTATTCCTTGATGGAGGATGGAGCCATGAACTTTTGAACACAATTCAGTTCTAAACGTCCTTATGGAGGACTTGGAGCATCAGCAGGCCAT

Full Affymetrix probeset data:

Annotations for 1627465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720