FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627467_at:

>probe:Drosophila_2:1627467_at:534:165; Interrogation_Position=203; Antisense; AAATCCGTTTGCAAGGACGCACAAT
>probe:Drosophila_2:1627467_at:145:411; Interrogation_Position=218; Antisense; GACGCACAATGGACCTCATCAAGGA
>probe:Drosophila_2:1627467_at:410:241; Interrogation_Position=254; Antisense; AATACATGGCCCTCGAGGCGGAGAT
>probe:Drosophila_2:1627467_at:306:333; Interrogation_Position=339; Antisense; GCTGGCCGAGTCTTCAATCTGTGCA
>probe:Drosophila_2:1627467_at:399:77; Interrogation_Position=374; Antisense; AGGTTCTGTCCTACGAAGAGGCTCT
>probe:Drosophila_2:1627467_at:529:213; Interrogation_Position=389; Antisense; AAGAGGCTCTCCTGCGAAACACCAA
>probe:Drosophila_2:1627467_at:476:225; Interrogation_Position=439; Antisense; AAGGCCCGTTTGAGATCGCGTTCCA
>probe:Drosophila_2:1627467_at:306:519; Interrogation_Position=475; Antisense; GTGGAGAAACTCCTTCAACAGGCCC
>probe:Drosophila_2:1627467_at:690:77; Interrogation_Position=554; Antisense; AGGATCCGAAGAACCCAGACAACCA
>probe:Drosophila_2:1627467_at:331:165; Interrogation_Position=600; Antisense; AAATCTCTATGATCTGGTCATGCAG
>probe:Drosophila_2:1627467_at:592:579; Interrogation_Position=636; Antisense; GGCCAAGAGGCAACAGACCGATCTA
>probe:Drosophila_2:1627467_at:6:17; Interrogation_Position=671; Antisense; ATTTCCCTGGAACTCGAGCAATTCG
>probe:Drosophila_2:1627467_at:131:523; Interrogation_Position=697; Antisense; GTGGCCACATTTGATCCAGTTGTAT
>probe:Drosophila_2:1627467_at:617:251; Interrogation_Position=732; Antisense; CAAGTGAGACACTGCCAAGCTGAAT

Paste this into a BLAST search page for me
AAATCCGTTTGCAAGGACGCACAATGACGCACAATGGACCTCATCAAGGAAATACATGGCCCTCGAGGCGGAGATGCTGGCCGAGTCTTCAATCTGTGCAAGGTTCTGTCCTACGAAGAGGCTCTAAGAGGCTCTCCTGCGAAACACCAAAAGGCCCGTTTGAGATCGCGTTCCAGTGGAGAAACTCCTTCAACAGGCCCAGGATCCGAAGAACCCAGACAACCAAAATCTCTATGATCTGGTCATGCAGGGCCAAGAGGCAACAGACCGATCTAATTTCCCTGGAACTCGAGCAATTCGGTGGCCACATTTGATCCAGTTGTATCAAGTGAGACACTGCCAAGCTGAAT

Full Affymetrix probeset data:

Annotations for 1627467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720