FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627469_at:

>probe:Drosophila_2:1627469_at:79:187; Interrogation_Position=256; Antisense; AACAAGTACGTCCTAATGCTGCAGC
>probe:Drosophila_2:1627469_at:643:481; Interrogation_Position=282; Antisense; GTATAACACTAGCATGGTCCTGGGT
>probe:Drosophila_2:1627469_at:600:639; Interrogation_Position=363; Antisense; TCGGCAAGCTGATCTTACGCGCGGA
>probe:Drosophila_2:1627469_at:530:439; Interrogation_Position=396; Antisense; GAGGCGCAACTATCGAAATTTCTGG
>probe:Drosophila_2:1627469_at:496:133; Interrogation_Position=485; Antisense; ACTCGATTAGTAGCACAGCCGTGGC
>probe:Drosophila_2:1627469_at:640:579; Interrogation_Position=506; Antisense; TGGCCGTGCTGTATACTCCTATTAG
>probe:Drosophila_2:1627469_at:614:35; Interrogation_Position=552; Antisense; ATCATGGTTCCACAGACTCGACGAG
>probe:Drosophila_2:1627469_at:42:417; Interrogation_Position=574; Antisense; GAGCCGTGGCTTAGCGATCTCATAA
>probe:Drosophila_2:1627469_at:473:267; Interrogation_Position=641; Antisense; CAGTGGATGCGTTGGCTACTCTAAC
>probe:Drosophila_2:1627469_at:367:663; Interrogation_Position=668; Antisense; TAAACGAATCCTCACACTATGGCCG
>probe:Drosophila_2:1627469_at:567:257; Interrogation_Position=693; Antisense; CACTTCCTATCCATATCTGTATCGG
>probe:Drosophila_2:1627469_at:146:565; Interrogation_Position=736; Antisense; GGCTACAAGGGCTTCTTTTTTGGAT
>probe:Drosophila_2:1627469_at:321:559; Interrogation_Position=761; Antisense; GGAAACCGGCACTAATGGCCCTTAT
>probe:Drosophila_2:1627469_at:136:483; Interrogation_Position=811; Antisense; GTATATCGCTTCTTACTAGATCGCT

Paste this into a BLAST search page for me
AACAAGTACGTCCTAATGCTGCAGCGTATAACACTAGCATGGTCCTGGGTTCGGCAAGCTGATCTTACGCGCGGAGAGGCGCAACTATCGAAATTTCTGGACTCGATTAGTAGCACAGCCGTGGCTGGCCGTGCTGTATACTCCTATTAGATCATGGTTCCACAGACTCGACGAGGAGCCGTGGCTTAGCGATCTCATAACAGTGGATGCGTTGGCTACTCTAACTAAACGAATCCTCACACTATGGCCGCACTTCCTATCCATATCTGTATCGGGGCTACAAGGGCTTCTTTTTTGGATGGAAACCGGCACTAATGGCCCTTATGTATATCGCTTCTTACTAGATCGCT

Full Affymetrix probeset data:

Annotations for 1627469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720