Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627470_at:

>probe:Drosophila_2:1627470_at:361:355; Interrogation_Position=2844; Antisense; GCACTTTGCCCAAAATTCATCGCAG
>probe:Drosophila_2:1627470_at:672:43; Interrogation_Position=2862; Antisense; ATCGCAGTGCCAGTGAACCAAACTT
>probe:Drosophila_2:1627470_at:501:191; Interrogation_Position=2882; Antisense; AACTTGACGCAATCGCAGCTGCAGA
>probe:Drosophila_2:1627470_at:228:199; Interrogation_Position=2906; Antisense; AACGATGAGTTTCTGTATCTGCCCA
>probe:Drosophila_2:1627470_at:198:187; Interrogation_Position=2954; Antisense; AACAACTTTCAGTTCTTCGGCAGCG
>probe:Drosophila_2:1627470_at:468:289; Interrogation_Position=2971; Antisense; CGGCAGCGCTGGGAATATCTAGACA
>probe:Drosophila_2:1627470_at:402:675; Interrogation_Position=2990; Antisense; TAGACAGCGACCTGTACCTGTACTT
>probe:Drosophila_2:1627470_at:280:601; Interrogation_Position=3008; Antisense; TGTACTTACATATATCCTGCGTGAT
>probe:Drosophila_2:1627470_at:336:455; Interrogation_Position=3030; Antisense; GATCAACGTGATCCTACATCTATAT
>probe:Drosophila_2:1627470_at:321:23; Interrogation_Position=3051; Antisense; ATATACTTTTTGTTCTTGTCCCTCT
>probe:Drosophila_2:1627470_at:500:501; Interrogation_Position=3068; Antisense; GTCCCTCTGTACATAAGCGATTCGC
>probe:Drosophila_2:1627470_at:332:177; Interrogation_Position=3183; Antisense; AAACTTGCTTCTTTCCTTGGAACTG
>probe:Drosophila_2:1627470_at:545:509; Interrogation_Position=3213; Antisense; GTGCATTTCTGTTACCACACACAAA
>probe:Drosophila_2:1627470_at:603:193; Interrogation_Position=3259; Antisense; AACTGCAACGCCCATGTGTACATAA

Paste this into a BLAST search page for me
GCACTTTGCCCAAAATTCATCGCAGATCGCAGTGCCAGTGAACCAAACTTAACTTGACGCAATCGCAGCTGCAGAAACGATGAGTTTCTGTATCTGCCCAAACAACTTTCAGTTCTTCGGCAGCGCGGCAGCGCTGGGAATATCTAGACATAGACAGCGACCTGTACCTGTACTTTGTACTTACATATATCCTGCGTGATGATCAACGTGATCCTACATCTATATATATACTTTTTGTTCTTGTCCCTCTGTCCCTCTGTACATAAGCGATTCGCAAACTTGCTTCTTTCCTTGGAACTGGTGCATTTCTGTTACCACACACAAAAACTGCAACGCCCATGTGTACATAA

Full Affymetrix probeset data:

Annotations for 1627470_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime