FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627471_at:

>probe:Drosophila_2:1627471_at:87:189; Interrogation_Position=1133; Antisense; AACAGCAGCAGAGATCGCCCATCGA
>probe:Drosophila_2:1627471_at:599:97; Interrogation_Position=1144; Antisense; AGATCGCCCATCGACGTCCTGATGA
>probe:Drosophila_2:1627471_at:244:135; Interrogation_Position=1157; Antisense; ACGTCCTGATGAGGGTGTTCCCCAA
>probe:Drosophila_2:1627471_at:243:621; Interrogation_Position=1232; Antisense; TGCTCCAGGCCATGGAGTGCATGCT
>probe:Drosophila_2:1627471_at:506:75; Interrogation_Position=1265; Antisense; AGGATTTGGGACAGACTCCGCCGCA
>probe:Drosophila_2:1627471_at:608:713; Interrogation_Position=1384; Antisense; TTCATGCAGGCGCACGCCAAGCGAT
>probe:Drosophila_2:1627471_at:203:207; Interrogation_Position=1402; Antisense; AAGCGATTCCTGACTGCTCCCTACG
>probe:Drosophila_2:1627471_at:172:659; Interrogation_Position=1438; Antisense; TACCTTCCGGGAGTGCTCAGTGCGG
>probe:Drosophila_2:1627471_at:286:281; Interrogation_Position=1453; Antisense; CTCAGTGCGGCGGATATCGAGCAAT
>probe:Drosophila_2:1627471_at:189:457; Interrogation_Position=1465; Antisense; GATATCGAGCAATCCGAGTCCAACG
>probe:Drosophila_2:1627471_at:286:79; Interrogation_Position=1503; Antisense; AGGGTTGGATCGCACCAGCAATGCT
>probe:Drosophila_2:1627471_at:469:111; Interrogation_Position=1519; Antisense; AGCAATGCTGGCGACTCCCAGGATT
>probe:Drosophila_2:1627471_at:328:711; Interrogation_Position=949; Antisense; TTCAGCAGCAGTCATGCCCAGGGCT
>probe:Drosophila_2:1627471_at:387:49; Interrogation_Position=962; Antisense; ATGCCCAGGGCTTCCTGCCATATCA

Paste this into a BLAST search page for me
AACAGCAGCAGAGATCGCCCATCGAAGATCGCCCATCGACGTCCTGATGAACGTCCTGATGAGGGTGTTCCCCAATGCTCCAGGCCATGGAGTGCATGCTAGGATTTGGGACAGACTCCGCCGCATTCATGCAGGCGCACGCCAAGCGATAAGCGATTCCTGACTGCTCCCTACGTACCTTCCGGGAGTGCTCAGTGCGGCTCAGTGCGGCGGATATCGAGCAATGATATCGAGCAATCCGAGTCCAACGAGGGTTGGATCGCACCAGCAATGCTAGCAATGCTGGCGACTCCCAGGATTTTCAGCAGCAGTCATGCCCAGGGCTATGCCCAGGGCTTCCTGCCATATCA

Full Affymetrix probeset data:

Annotations for 1627471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720