Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627472_at:

>probe:Drosophila_2:1627472_at:339:517; Interrogation_Position=1055; Antisense; GTGGCGGAGACCTCTGGTGACTACA
>probe:Drosophila_2:1627472_at:210:103; Interrogation_Position=1062; Antisense; AGACCTCTGGTGACTACAAGCGGGC
>probe:Drosophila_2:1627472_at:362:591; Interrogation_Position=1069; Antisense; TGGTGACTACAAGCGGGCCCTGACA
>probe:Drosophila_2:1627472_at:93:613; Interrogation_Position=1089; Antisense; TGACAGCCCTACTTGGATCCGCCTA
>probe:Drosophila_2:1627472_at:276:587; Interrogation_Position=1102; Antisense; TGGATCCGCCTAGGCCCGAGGATGT
>probe:Drosophila_2:1627472_at:194:547; Interrogation_Position=1121; Antisense; GGATGTGGCAGCTGGTCCGCCCAAT
>probe:Drosophila_2:1627472_at:599:471; Interrogation_Position=1134; Antisense; GGTCCGCCCAATATTTTATTCGTGT
>probe:Drosophila_2:1627472_at:692:689; Interrogation_Position=1150; Antisense; TATTCGTGTTAATAGCTTTGATCGT
>probe:Drosophila_2:1627472_at:672:341; Interrogation_Position=1164; Antisense; GCTTTGATCGTAGTGTGCCTTTTAG
>probe:Drosophila_2:1627472_at:691:515; Interrogation_Position=1176; Antisense; GTGTGCCTTTTAGGAAAATCGCTTT
>probe:Drosophila_2:1627472_at:561:387; Interrogation_Position=1189; Antisense; GAAAATCGCTTTTAATGTCGTCTGC
>probe:Drosophila_2:1627472_at:434:701; Interrogation_Position=1198; Antisense; TTTTAATGTCGTCTGCGCATGCGCA
>probe:Drosophila_2:1627472_at:316:323; Interrogation_Position=1212; Antisense; GCGCATGCGCACACTGTTGGCAATA
>probe:Drosophila_2:1627472_at:70:241; Interrogation_Position=1237; Antisense; AATAAACGCATATAGCAGCAGTTGT

Paste this into a BLAST search page for me
GTGGCGGAGACCTCTGGTGACTACAAGACCTCTGGTGACTACAAGCGGGCTGGTGACTACAAGCGGGCCCTGACATGACAGCCCTACTTGGATCCGCCTATGGATCCGCCTAGGCCCGAGGATGTGGATGTGGCAGCTGGTCCGCCCAATGGTCCGCCCAATATTTTATTCGTGTTATTCGTGTTAATAGCTTTGATCGTGCTTTGATCGTAGTGTGCCTTTTAGGTGTGCCTTTTAGGAAAATCGCTTTGAAAATCGCTTTTAATGTCGTCTGCTTTTAATGTCGTCTGCGCATGCGCAGCGCATGCGCACACTGTTGGCAATAAATAAACGCATATAGCAGCAGTTGT

Full Affymetrix probeset data:

Annotations for 1627472_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime