Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627473_at:

>probe:Drosophila_2:1627473_at:109:101; Interrogation_Position=1094; Antisense; AGAGTCGGTCGCAAGGATCCAGTCA
>probe:Drosophila_2:1627473_at:204:447; Interrogation_Position=1109; Antisense; GATCCAGTCACACGAGGCCTTGAAA
>probe:Drosophila_2:1627473_at:334:163; Interrogation_Position=1131; Antisense; AAATTGCCATACACTGGTGCGGCTT
>probe:Drosophila_2:1627473_at:447:189; Interrogation_Position=1157; Antisense; AACATTGACTTTGCGTTCTGGAATC
>probe:Drosophila_2:1627473_at:147:345; Interrogation_Position=1183; Antisense; GCATATATCATTTCTGCTCGTCGGC
>probe:Drosophila_2:1627473_at:698:571; Interrogation_Position=1205; Antisense; GGCTGCATTGTGATCACCTCGATTA
>probe:Drosophila_2:1627473_at:697:63; Interrogation_Position=1319; Antisense; ATGGGCATGTACTTCTGTTCCTCAG
>probe:Drosophila_2:1627473_at:356:153; Interrogation_Position=1362; Antisense; ACATGCCAGCCGAGTATCGTGTGAT
>probe:Drosophila_2:1627473_at:511:517; Interrogation_Position=1380; Antisense; GTGTGATCATCACCGAGGTTCTAGG
>probe:Drosophila_2:1627473_at:478:161; Interrogation_Position=1405; Antisense; AAATCTGCACTTCAACTTCTACCAT
>probe:Drosophila_2:1627473_at:113:409; Interrogation_Position=1439; Antisense; GACGTAATATTCCTGGTCAGCGCAT
>probe:Drosophila_2:1627473_at:88:345; Interrogation_Position=1460; Antisense; GCATTGACCACCATCATTGTTCTAT
>probe:Drosophila_2:1627473_at:670:601; Interrogation_Position=1477; Antisense; TGTTCTATATCTGTCACGCAAGCCA
>probe:Drosophila_2:1627473_at:379:203; Interrogation_Position=1496; Antisense; AAGCCAGTTCGCGTGGACGATTCCG

Paste this into a BLAST search page for me
AGAGTCGGTCGCAAGGATCCAGTCAGATCCAGTCACACGAGGCCTTGAAAAAATTGCCATACACTGGTGCGGCTTAACATTGACTTTGCGTTCTGGAATCGCATATATCATTTCTGCTCGTCGGCGGCTGCATTGTGATCACCTCGATTAATGGGCATGTACTTCTGTTCCTCAGACATGCCAGCCGAGTATCGTGTGATGTGTGATCATCACCGAGGTTCTAGGAAATCTGCACTTCAACTTCTACCATGACGTAATATTCCTGGTCAGCGCATGCATTGACCACCATCATTGTTCTATTGTTCTATATCTGTCACGCAAGCCAAAGCCAGTTCGCGTGGACGATTCCG

Full Affymetrix probeset data:

Annotations for 1627473_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime