FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627476_at:

>probe:Drosophila_2:1627476_at:620:221; Interrogation_Position=1067; Antisense; AAGTGGTGGATTCGCGACCCTTTGA
>probe:Drosophila_2:1627476_at:243:549; Interrogation_Position=1143; Antisense; GGAGGACGCACTGCAGCTTTACAGA
>probe:Drosophila_2:1627476_at:175:565; Interrogation_Position=1197; Antisense; GGAATCTTTGGCCAGCATTGCTGTG
>probe:Drosophila_2:1627476_at:68:519; Interrogation_Position=1219; Antisense; GTGGGCTACTTTTACGACAACAATC
>probe:Drosophila_2:1627476_at:108:169; Interrogation_Position=1247; Antisense; AAATGGCGTTGATGTACTACCGGAG
>probe:Drosophila_2:1627476_at:289:499; Interrogation_Position=1293; Antisense; GTCTCCTGAGCTCTACTGCAATATA
>probe:Drosophila_2:1627476_at:696:163; Interrogation_Position=1343; Antisense; AAATCGACTTGGTTCTGCCGTGTTT
>probe:Drosophila_2:1627476_at:430:191; Interrogation_Position=1394; Antisense; AACCCGGCCAAAAGTCAGACATCTG
>probe:Drosophila_2:1627476_at:512:5; Interrogation_Position=1424; Antisense; ATCTCAGTTTTGTGGCGGTGACTTC
>probe:Drosophila_2:1627476_at:9:531; Interrogation_Position=1440; Antisense; GGTGACTTCTGGTGACTTCAACCTA
>probe:Drosophila_2:1627476_at:344:183; Interrogation_Position=1468; Antisense; AAAAGGTGTCTCCAACTATGCCTCA
>probe:Drosophila_2:1627476_at:502:447; Interrogation_Position=1498; Antisense; GATGCCCAGAATGGAGCCGCACTTA
>probe:Drosophila_2:1627476_at:579:309; Interrogation_Position=1588; Antisense; GCCAAGGATGTGATGCCCGATGCTG
>probe:Drosophila_2:1627476_at:96:539; Interrogation_Position=1617; Antisense; GGTAACCACCAATCTGCAATTCATG

Paste this into a BLAST search page for me
AAGTGGTGGATTCGCGACCCTTTGAGGAGGACGCACTGCAGCTTTACAGAGGAATCTTTGGCCAGCATTGCTGTGGTGGGCTACTTTTACGACAACAATCAAATGGCGTTGATGTACTACCGGAGGTCTCCTGAGCTCTACTGCAATATAAAATCGACTTGGTTCTGCCGTGTTTAACCCGGCCAAAAGTCAGACATCTGATCTCAGTTTTGTGGCGGTGACTTCGGTGACTTCTGGTGACTTCAACCTAAAAAGGTGTCTCCAACTATGCCTCAGATGCCCAGAATGGAGCCGCACTTAGCCAAGGATGTGATGCCCGATGCTGGGTAACCACCAATCTGCAATTCATG

Full Affymetrix probeset data:

Annotations for 1627476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720