FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627481_at:

>probe:Drosophila_2:1627481_at:167:69; Interrogation_Position=1019; Antisense; AGGCCAAGTCTCTGGAGGCAGCTAA
>probe:Drosophila_2:1627481_at:307:89; Interrogation_Position=1088; Antisense; AGTCATTCAAGTTTCCCGGCGCGTA
>probe:Drosophila_2:1627481_at:305:681; Interrogation_Position=535; Antisense; TATTTGGGCAAGGATCACGAAGGTT
>probe:Drosophila_2:1627481_at:122:667; Interrogation_Position=565; Antisense; TACACCAGCCACGATTTGTGGAAGA
>probe:Drosophila_2:1627481_at:413:519; Interrogation_Position=595; Antisense; GTGGTCTGGAAATCGCACTGGAAGA
>probe:Drosophila_2:1627481_at:82:41; Interrogation_Position=622; Antisense; ATCTGGAAGCCAGCCAAGAAGCAAA
>probe:Drosophila_2:1627481_at:31:39; Interrogation_Position=808; Antisense; ATCTGGAAGCCAGTGGTCATTTCAG
>probe:Drosophila_2:1627481_at:170:535; Interrogation_Position=822; Antisense; GGTCATTTCAGAATGGTTCCCCTCG
>probe:Drosophila_2:1627481_at:351:57; Interrogation_Position=872; Antisense; ATGAGCACCATGATTGGGATCGCAA
>probe:Drosophila_2:1627481_at:699:527; Interrogation_Position=887; Antisense; GGGATCGCAAGGACACAGGTGTTAC
>probe:Drosophila_2:1627481_at:324:603; Interrogation_Position=906; Antisense; TGTTACGGCCACCAGGACGGCAGAT
>probe:Drosophila_2:1627481_at:395:177; Interrogation_Position=952; Antisense; AAACGAGATGACACCAATGCCGCTG
>probe:Drosophila_2:1627481_at:172:49; Interrogation_Position=968; Antisense; ATGCCGCTGGCAAGCCAACAATGCT
>probe:Drosophila_2:1627481_at:28:187; Interrogation_Position=984; Antisense; AACAATGCTGCAGCCAGTGGCCAGC

Paste this into a BLAST search page for me
AGGCCAAGTCTCTGGAGGCAGCTAAAGTCATTCAAGTTTCCCGGCGCGTATATTTGGGCAAGGATCACGAAGGTTTACACCAGCCACGATTTGTGGAAGAGTGGTCTGGAAATCGCACTGGAAGAATCTGGAAGCCAGCCAAGAAGCAAAATCTGGAAGCCAGTGGTCATTTCAGGGTCATTTCAGAATGGTTCCCCTCGATGAGCACCATGATTGGGATCGCAAGGGATCGCAAGGACACAGGTGTTACTGTTACGGCCACCAGGACGGCAGATAAACGAGATGACACCAATGCCGCTGATGCCGCTGGCAAGCCAACAATGCTAACAATGCTGCAGCCAGTGGCCAGC

Full Affymetrix probeset data:

Annotations for 1627481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720