FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627483_at:

>probe:Drosophila_2:1627483_at:559:3; Interrogation_Position=101; Antisense; ATTGGCTTTGTGCTCGGAATCGATA
>probe:Drosophila_2:1627483_at:268:565; Interrogation_Position=116; Antisense; GGAATCGATACATGCGCTGCGCTGC
>probe:Drosophila_2:1627483_at:193:337; Interrogation_Position=131; Antisense; GCTGCGCTGCTCGAATTATCACGTG
>probe:Drosophila_2:1627483_at:725:243; Interrogation_Position=144; Antisense; AATTATCACGTGCTCGGTGACTGGG
>probe:Drosophila_2:1627483_at:295:33; Interrogation_Position=178; Antisense; ATCAAGAACCAGCAACACAACCACG
>probe:Drosophila_2:1627483_at:512:167; Interrogation_Position=231; Antisense; AAAGGAGAAACCACTGTCCTCTAGC
>probe:Drosophila_2:1627483_at:67:287; Interrogation_Position=244; Antisense; CTGTCCTCTAGCCTTAAGTCTAAAG
>probe:Drosophila_2:1627483_at:444:711; Interrogation_Position=257; Antisense; TTAAGTCTAAAGATCCCGAGCATTA
>probe:Drosophila_2:1627483_at:287:169; Interrogation_Position=31; Antisense; AAAGGAAAGCCCAAACTGCTGATGG
>probe:Drosophila_2:1627483_at:368:255; Interrogation_Position=42; Antisense; CAAACTGCTGATGGGCGGCTACGAG
>probe:Drosophila_2:1627483_at:678:573; Interrogation_Position=55; Antisense; GGCGGCTACGAGTATTATCGCAACA
>probe:Drosophila_2:1627483_at:455:429; Interrogation_Position=64; Antisense; GAGTATTATCGCAACAATTCGCGGG
>probe:Drosophila_2:1627483_at:386:521; Interrogation_Position=87; Antisense; GGGCTCCAAAACGTATTGGCTTTGT
>probe:Drosophila_2:1627483_at:319:177; Interrogation_Position=95; Antisense; AAACGTATTGGCTTTGTGCTCGGAA

Paste this into a BLAST search page for me
ATTGGCTTTGTGCTCGGAATCGATAGGAATCGATACATGCGCTGCGCTGCGCTGCGCTGCTCGAATTATCACGTGAATTATCACGTGCTCGGTGACTGGGATCAAGAACCAGCAACACAACCACGAAAGGAGAAACCACTGTCCTCTAGCCTGTCCTCTAGCCTTAAGTCTAAAGTTAAGTCTAAAGATCCCGAGCATTAAAAGGAAAGCCCAAACTGCTGATGGCAAACTGCTGATGGGCGGCTACGAGGGCGGCTACGAGTATTATCGCAACAGAGTATTATCGCAACAATTCGCGGGGGGCTCCAAAACGTATTGGCTTTGTAAACGTATTGGCTTTGTGCTCGGAA

Full Affymetrix probeset data:

Annotations for 1627483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720