Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627484_at:

>probe:Drosophila_2:1627484_at:234:401; Interrogation_Position=100; Antisense; GACTTGGGAAGCTATAACTACTACA
>probe:Drosophila_2:1627484_at:532:597; Interrogation_Position=23; Antisense; TGTCATTCGCAGTACAGGTGCAAAC
>probe:Drosophila_2:1627484_at:34:79; Interrogation_Position=230; Antisense; AGGATCCGTGCGAGCGCAGCTGTCC
>probe:Drosophila_2:1627484_at:607:537; Interrogation_Position=257; Antisense; GGTACTACCGGCCTGTCTGCATTCT
>probe:Drosophila_2:1627484_at:354:11; Interrogation_Position=277; Antisense; ATTCTCCGCAATGGCCGCAATATGA
>probe:Drosophila_2:1627484_at:624:241; Interrogation_Position=295; Antisense; AATATGACATTTGCCACGCTCTGCG
>probe:Drosophila_2:1627484_at:639:337; Interrogation_Position=312; Antisense; GCTCTGCGAGTTCCACAATCAAGTA
>probe:Drosophila_2:1627484_at:295:467; Interrogation_Position=338; Antisense; GTTGTGCCAACGATCTAAGAAGACA
>probe:Drosophila_2:1627484_at:130:161; Interrogation_Position=360; Antisense; ACAAGGTCATGGCTATGTGGTCCCC
>probe:Drosophila_2:1627484_at:23:597; Interrogation_Position=375; Antisense; TGTGGTCCCCATCTTTCAATACCAA
>probe:Drosophila_2:1627484_at:472:241; Interrogation_Position=392; Antisense; AATACCAACATGATGGTGGCTGCTA
>probe:Drosophila_2:1627484_at:382:197; Interrogation_Position=45; Antisense; AACGGAGCACACCATTGTGGAGGAA
>probe:Drosophila_2:1627484_at:240:73; Interrogation_Position=65; Antisense; AGGAATGGAGCTGGCAAGACCATCA
>probe:Drosophila_2:1627484_at:108:271; Interrogation_Position=85; Antisense; CATCACAGCAACAGAGACTTGGGAA

Paste this into a BLAST search page for me
GACTTGGGAAGCTATAACTACTACATGTCATTCGCAGTACAGGTGCAAACAGGATCCGTGCGAGCGCAGCTGTCCGGTACTACCGGCCTGTCTGCATTCTATTCTCCGCAATGGCCGCAATATGAAATATGACATTTGCCACGCTCTGCGGCTCTGCGAGTTCCACAATCAAGTAGTTGTGCCAACGATCTAAGAAGACAACAAGGTCATGGCTATGTGGTCCCCTGTGGTCCCCATCTTTCAATACCAAAATACCAACATGATGGTGGCTGCTAAACGGAGCACACCATTGTGGAGGAAAGGAATGGAGCTGGCAAGACCATCACATCACAGCAACAGAGACTTGGGAA

Full Affymetrix probeset data:

Annotations for 1627484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime