FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627487_at:

>probe:Drosophila_2:1627487_at:688:103; Interrogation_Position=1990; Antisense; AGACGCACATCCTCGGCAACGGAAT
>probe:Drosophila_2:1627487_at:132:567; Interrogation_Position=2004; Antisense; GGCAACGGAATACGCACCCATGCGG
>probe:Drosophila_2:1627487_at:34:133; Interrogation_Position=2019; Antisense; ACCCATGCGGGACAAACTGCTGTTG
>probe:Drosophila_2:1627487_at:390:209; Interrogation_Position=2134; Antisense; AAGCATCCCAATCTTCGGGTGCCGT
>probe:Drosophila_2:1627487_at:82:303; Interrogation_Position=2173; Antisense; CCGCCGCCGCAGAGTGAACTTGACA
>probe:Drosophila_2:1627487_at:644:383; Interrogation_Position=2188; Antisense; GAACTTGACATCAGTTATACCTTCG
>probe:Drosophila_2:1627487_at:468:703; Interrogation_Position=2202; Antisense; TTATACCTTCGATGAGCCATTGCCG
>probe:Drosophila_2:1627487_at:652:201; Interrogation_Position=2275; Antisense; AACCGGCGGAATTGCTTCGCCGGAG
>probe:Drosophila_2:1627487_at:233:533; Interrogation_Position=2370; Antisense; GGTGCCCAAGAAGCCAACGAGCTTG
>probe:Drosophila_2:1627487_at:457:379; Interrogation_Position=2379; Antisense; GAAGCCAACGAGCTTGCAGCACAAG
>probe:Drosophila_2:1627487_at:233:357; Interrogation_Position=2397; Antisense; GCACAAGCATCTCGCCAACGGAGGA
>probe:Drosophila_2:1627487_at:430:153; Interrogation_Position=2457; Antisense; ACAGCCCATCCTCGAAAATGTGGCC
>probe:Drosophila_2:1627487_at:631:33; Interrogation_Position=2464; Antisense; ATCCTCGAAAATGTGGCCAGTCCCG
>probe:Drosophila_2:1627487_at:79:111; Interrogation_Position=2551; Antisense; AGCAATCTGGAGAGCAACCAGCAGA

Paste this into a BLAST search page for me
AGACGCACATCCTCGGCAACGGAATGGCAACGGAATACGCACCCATGCGGACCCATGCGGGACAAACTGCTGTTGAAGCATCCCAATCTTCGGGTGCCGTCCGCCGCCGCAGAGTGAACTTGACAGAACTTGACATCAGTTATACCTTCGTTATACCTTCGATGAGCCATTGCCGAACCGGCGGAATTGCTTCGCCGGAGGGTGCCCAAGAAGCCAACGAGCTTGGAAGCCAACGAGCTTGCAGCACAAGGCACAAGCATCTCGCCAACGGAGGAACAGCCCATCCTCGAAAATGTGGCCATCCTCGAAAATGTGGCCAGTCCCGAGCAATCTGGAGAGCAACCAGCAGA

Full Affymetrix probeset data:

Annotations for 1627487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720