FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627488_at:

>probe:Drosophila_2:1627488_at:377:171; Interrogation_Position=1005; Antisense; AAAGAAGATTCTACACCGACCGGCT
>probe:Drosophila_2:1627488_at:581:71; Interrogation_Position=1091; Antisense; AGGACTAAGTCTGAATCCCGATCCC
>probe:Drosophila_2:1627488_at:469:431; Interrogation_Position=1119; Antisense; GAGTCAATTCTGTTTATCGCCCTTC
>probe:Drosophila_2:1627488_at:525:669; Interrogation_Position=1144; Antisense; TACGTACTGTTTCCTAGCAGAGCAT
>probe:Drosophila_2:1627488_at:513:709; Interrogation_Position=1195; Antisense; TTCTTTTGTGTTGTGTCTATCCCGT
>probe:Drosophila_2:1627488_at:709:683; Interrogation_Position=1212; Antisense; TATCCCGTGTCTATATGTGTCCGTA
>probe:Drosophila_2:1627488_at:278:63; Interrogation_Position=1226; Antisense; ATGTGTCCGTACGTCAGTCGATATC
>probe:Drosophila_2:1627488_at:111:439; Interrogation_Position=1255; Antisense; GAGGCACTAGGCATCAACTGAAACA
>probe:Drosophila_2:1627488_at:233:613; Interrogation_Position=1273; Antisense; TGAAACATCGCATAGCAGCCGCCAA
>probe:Drosophila_2:1627488_at:329:517; Interrogation_Position=1299; Antisense; GTGGGCTTCCTTAAATGTATTCTTG
>probe:Drosophila_2:1627488_at:684:471; Interrogation_Position=828; Antisense; GTTCGTCTACTCCATGCCTGGATAT
>probe:Drosophila_2:1627488_at:271:507; Interrogation_Position=862; Antisense; GTGCGCGAGCGCATGATGTACTCAA
>probe:Drosophila_2:1627488_at:19:489; Interrogation_Position=879; Antisense; GTACTCAAGCTGTAAGGCTCCTTTT
>probe:Drosophila_2:1627488_at:58:413; Interrogation_Position=972; Antisense; GACCGAAGCCTTCTTGCAGGACGAG

Paste this into a BLAST search page for me
AAAGAAGATTCTACACCGACCGGCTAGGACTAAGTCTGAATCCCGATCCCGAGTCAATTCTGTTTATCGCCCTTCTACGTACTGTTTCCTAGCAGAGCATTTCTTTTGTGTTGTGTCTATCCCGTTATCCCGTGTCTATATGTGTCCGTAATGTGTCCGTACGTCAGTCGATATCGAGGCACTAGGCATCAACTGAAACATGAAACATCGCATAGCAGCCGCCAAGTGGGCTTCCTTAAATGTATTCTTGGTTCGTCTACTCCATGCCTGGATATGTGCGCGAGCGCATGATGTACTCAAGTACTCAAGCTGTAAGGCTCCTTTTGACCGAAGCCTTCTTGCAGGACGAG

Full Affymetrix probeset data:

Annotations for 1627488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720