Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627489_a_at:

>probe:Drosophila_2:1627489_a_at:244:25; Interrogation_Position=366; Antisense; ATCGAACCCACCTCGAACAAGGGAT
>probe:Drosophila_2:1627489_a_at:299:5; Interrogation_Position=389; Antisense; ATTGTGTCCCACGAGTGCCGGAGAG
>probe:Drosophila_2:1627489_a_at:25:509; Interrogation_Position=457; Antisense; GTGCGGAACACCTGGGACAGTGCAT
>probe:Drosophila_2:1627489_a_at:699:399; Interrogation_Position=472; Antisense; GACAGTGCATGGACCGATGCCACCA
>probe:Drosophila_2:1627489_a_at:317:619; Interrogation_Position=505; Antisense; TGCGACCCGGTTCGGATTGCAAGAA
>probe:Drosophila_2:1627489_a_at:60:211; Interrogation_Position=525; Antisense; AAGAATGGCCAAGTCTGCTGCGTCC
>probe:Drosophila_2:1627489_a_at:337:619; Interrogation_Position=540; Antisense; TGCTGCGTCCTGATTTAGTTATACT
>probe:Drosophila_2:1627489_a_at:691:127; Interrogation_Position=572; Antisense; ACCATACACATACCCGTGCAGAGGA
>probe:Drosophila_2:1627489_a_at:400:241; Interrogation_Position=620; Antisense; AATAGCCTCCAAGTTGGGCAAGTCA
>probe:Drosophila_2:1627489_a_at:659:243; Interrogation_Position=765; Antisense; AATTTGGTTGTGTCATTCCTCTGTA
>probe:Drosophila_2:1627489_a_at:537:599; Interrogation_Position=775; Antisense; TGTCATTCCTCTGTACACATACACA
>probe:Drosophila_2:1627489_a_at:324:485; Interrogation_Position=872; Antisense; GTATGACATCTTAAGAGCCCCAAAT
>probe:Drosophila_2:1627489_a_at:523:319; Interrogation_Position=888; Antisense; GCCCCAAATCTACCCACAATGTGAA
>probe:Drosophila_2:1627489_a_at:325:511; Interrogation_Position=908; Antisense; GTGAAATATTTGACTGCTTCCAATA

Paste this into a BLAST search page for me
ATCGAACCCACCTCGAACAAGGGATATTGTGTCCCACGAGTGCCGGAGAGGTGCGGAACACCTGGGACAGTGCATGACAGTGCATGGACCGATGCCACCATGCGACCCGGTTCGGATTGCAAGAAAAGAATGGCCAAGTCTGCTGCGTCCTGCTGCGTCCTGATTTAGTTATACTACCATACACATACCCGTGCAGAGGAAATAGCCTCCAAGTTGGGCAAGTCAAATTTGGTTGTGTCATTCCTCTGTATGTCATTCCTCTGTACACATACACAGTATGACATCTTAAGAGCCCCAAATGCCCCAAATCTACCCACAATGTGAAGTGAAATATTTGACTGCTTCCAATA

Full Affymetrix probeset data:

Annotations for 1627489_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime