FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627491_at:

>probe:Drosophila_2:1627491_at:20:575; Interrogation_Position=1499; Antisense; GGCGGCGGAGCACAAGATCATCATT
>probe:Drosophila_2:1627491_at:482:453; Interrogation_Position=1514; Antisense; GATCATCATTATTTAGCTGGCGTCG
>probe:Drosophila_2:1627491_at:415:133; Interrogation_Position=1599; Antisense; ACGCTCGTACGATCCATATATGTTT
>probe:Drosophila_2:1627491_at:498:49; Interrogation_Position=1627; Antisense; ATGCGTTACATGCTTGACACACGTA
>probe:Drosophila_2:1627491_at:119:19; Interrogation_Position=1665; Antisense; ATTTGGTTGCCAGTAGTCGCGGAAC
>probe:Drosophila_2:1627491_at:249:325; Interrogation_Position=1704; Antisense; GCTGCAATTTAGTTAACCGTGTCCA
>probe:Drosophila_2:1627491_at:406:515; Interrogation_Position=1722; Antisense; GTGTCCATTAAATTGCACCCATAAG
>probe:Drosophila_2:1627491_at:682:261; Interrogation_Position=1800; Antisense; CAGCCGGTGGGTTTTGTACATCCTA
>probe:Drosophila_2:1627491_at:688:451; Interrogation_Position=1837; Antisense; GATCGGCTCCCTTTGGAATTTAGTT
>probe:Drosophila_2:1627491_at:256:695; Interrogation_Position=1865; Antisense; TTTCGCGGGCTAATGGCGGTGACCA
>probe:Drosophila_2:1627491_at:525:105; Interrogation_Position=1907; Antisense; AGAAATCCCCAGAGGTGTCTCCTTG
>probe:Drosophila_2:1627491_at:437:591; Interrogation_Position=1930; Antisense; TGGGCGCAAGCCATTTTCCGGACGT
>probe:Drosophila_2:1627491_at:58:125; Interrogation_Position=1945; Antisense; TTCCGGACGTTTATTCTTTGCCAAG
>probe:Drosophila_2:1627491_at:443:657; Interrogation_Position=1998; Antisense; TAAGGCCTGGAGTTGTAAGCCCTAA

Paste this into a BLAST search page for me
GGCGGCGGAGCACAAGATCATCATTGATCATCATTATTTAGCTGGCGTCGACGCTCGTACGATCCATATATGTTTATGCGTTACATGCTTGACACACGTAATTTGGTTGCCAGTAGTCGCGGAACGCTGCAATTTAGTTAACCGTGTCCAGTGTCCATTAAATTGCACCCATAAGCAGCCGGTGGGTTTTGTACATCCTAGATCGGCTCCCTTTGGAATTTAGTTTTTCGCGGGCTAATGGCGGTGACCAAGAAATCCCCAGAGGTGTCTCCTTGTGGGCGCAAGCCATTTTCCGGACGTTTCCGGACGTTTATTCTTTGCCAAGTAAGGCCTGGAGTTGTAAGCCCTAA

Full Affymetrix probeset data:

Annotations for 1627491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720