FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627493_at:

>probe:Drosophila_2:1627493_at:637:513; Interrogation_Position=1004; Antisense; GTGATTGGCCCCATTTCAATACTAC
>probe:Drosophila_2:1627493_at:569:241; Interrogation_Position=1021; Antisense; AATACTACACTGACATTCGCATCCT
>probe:Drosophila_2:1627493_at:716:401; Interrogation_Position=1032; Antisense; GACATTCGCATCCTACATTGACATT
>probe:Drosophila_2:1627493_at:266:443; Interrogation_Position=554; Antisense; GATGTTCCGCATGCTCTACATGGTA
>probe:Drosophila_2:1627493_at:694:641; Interrogation_Position=625; Antisense; TCTGCATCATGGACTTCGAGGGACT
>probe:Drosophila_2:1627493_at:686:79; Interrogation_Position=661; Antisense; AGGTGAAGGCCCTGTCGCCGAGCTT
>probe:Drosophila_2:1627493_at:277:205; Interrogation_Position=690; Antisense; AAGCGATTGCTCACATTCATCCAGG
>probe:Drosophila_2:1627493_at:607:69; Interrogation_Position=715; Antisense; AGGCGATGCCCCTTCGCATGAAGGA
>probe:Drosophila_2:1627493_at:387:507; Interrogation_Position=741; Antisense; GTGCACTTCGTGAAGCAGCCGTTCA
>probe:Drosophila_2:1627493_at:163:263; Interrogation_Position=756; Antisense; CAGCCGTTCATCTTCAACATGGTTT
>probe:Drosophila_2:1627493_at:721:189; Interrogation_Position=771; Antisense; AACATGGTTTGGTCGCTCTTCAAGC
>probe:Drosophila_2:1627493_at:679:241; Interrogation_Position=819; Antisense; AATAGGATGCACTTCCACGGCAGTG
>probe:Drosophila_2:1627493_at:366:53; Interrogation_Position=846; Antisense; ATGAAGTCGTTGCAGAAGTTCCTCG
>probe:Drosophila_2:1627493_at:319:193; Interrogation_Position=891; Antisense; AACTACAAGGGTACTCTGCCCGCGA

Paste this into a BLAST search page for me
GTGATTGGCCCCATTTCAATACTACAATACTACACTGACATTCGCATCCTGACATTCGCATCCTACATTGACATTGATGTTCCGCATGCTCTACATGGTATCTGCATCATGGACTTCGAGGGACTAGGTGAAGGCCCTGTCGCCGAGCTTAAGCGATTGCTCACATTCATCCAGGAGGCGATGCCCCTTCGCATGAAGGAGTGCACTTCGTGAAGCAGCCGTTCACAGCCGTTCATCTTCAACATGGTTTAACATGGTTTGGTCGCTCTTCAAGCAATAGGATGCACTTCCACGGCAGTGATGAAGTCGTTGCAGAAGTTCCTCGAACTACAAGGGTACTCTGCCCGCGA

Full Affymetrix probeset data:

Annotations for 1627493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720