Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627496_at:

>probe:Drosophila_2:1627496_at:266:221; Interrogation_Position=1000; Antisense; AAGTGTGTCCGTGCTCAGAGCCTGG
>probe:Drosophila_2:1627496_at:214:545; Interrogation_Position=1038; Antisense; GGATGATCTACGAGGCAGCAACTGC
>probe:Drosophila_2:1627496_at:214:607; Interrogation_Position=1130; Antisense; TGATGCGCCAGCACTCGACAGAGAG
>probe:Drosophila_2:1627496_at:148:417; Interrogation_Position=1168; Antisense; GAGCGGGATCGAAGCTCCCTTATGG
>probe:Drosophila_2:1627496_at:209:535; Interrogation_Position=1193; Antisense; GGTCCACGCAACGTATATCGCTGTA
>probe:Drosophila_2:1627496_at:244:45; Interrogation_Position=1209; Antisense; ATCGCTGTACGATGCACACAAGCTG
>probe:Drosophila_2:1627496_at:519:645; Interrogation_Position=1300; Antisense; TCTTCGCTGCACAGGCGTCATAAAT
>probe:Drosophila_2:1627496_at:404:369; Interrogation_Position=1337; Antisense; GAATGCGAGAGTGCGTCACCTGTGC
>probe:Drosophila_2:1627496_at:52:63; Interrogation_Position=1364; Antisense; ATGTGTTCCTGGAGGCCATGGGCAA
>probe:Drosophila_2:1627496_at:20:361; Interrogation_Position=1385; Antisense; GCAATGCCTGCACCCTGAAAAATAA
>probe:Drosophila_2:1627496_at:573:31; Interrogation_Position=1409; Antisense; ATAACTCTAGTCGATATACCCGTAT
>probe:Drosophila_2:1627496_at:372:31; Interrogation_Position=1432; Antisense; ATAACGGACCCTATCATTGGAGAGC
>probe:Drosophila_2:1627496_at:350:553; Interrogation_Position=1489; Antisense; GGAGCTGATCTCCAGTTGCTAAGTA
>probe:Drosophila_2:1627496_at:448:251; Interrogation_Position=936; Antisense; CAAGGGATCGCCCAAATACGCGGTA

Paste this into a BLAST search page for me
AAGTGTGTCCGTGCTCAGAGCCTGGGGATGATCTACGAGGCAGCAACTGCTGATGCGCCAGCACTCGACAGAGAGGAGCGGGATCGAAGCTCCCTTATGGGGTCCACGCAACGTATATCGCTGTAATCGCTGTACGATGCACACAAGCTGTCTTCGCTGCACAGGCGTCATAAATGAATGCGAGAGTGCGTCACCTGTGCATGTGTTCCTGGAGGCCATGGGCAAGCAATGCCTGCACCCTGAAAAATAAATAACTCTAGTCGATATACCCGTATATAACGGACCCTATCATTGGAGAGCGGAGCTGATCTCCAGTTGCTAAGTACAAGGGATCGCCCAAATACGCGGTA

Full Affymetrix probeset data:

Annotations for 1627496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime