FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627497_at:

>probe:Drosophila_2:1627497_at:84:525; Interrogation_Position=1024; Antisense; GGGCGAGAGCCACTAAGGTTCCATT
>probe:Drosophila_2:1627497_at:571:699; Interrogation_Position=1053; Antisense; TTTTCAGCGTTTTTCCCCAATGACG
>probe:Drosophila_2:1627497_at:545:503; Interrogation_Position=1077; Antisense; GTCCCAGCATTTCTTTTCAACTTTG
>probe:Drosophila_2:1627497_at:360:507; Interrogation_Position=574; Antisense; GTGCGAGTGCCTCAACGAAGCTGAT
>probe:Drosophila_2:1627497_at:86:341; Interrogation_Position=636; Antisense; GCTACCTGCAGTCCGATTGCGATGA
>probe:Drosophila_2:1627497_at:645:503; Interrogation_Position=673; Antisense; GTCCATCACCTTTAATCAGGCTGTG
>probe:Drosophila_2:1627497_at:237:269; Interrogation_Position=689; Antisense; CAGGCTGTGAAGATCCACTCTTTGA
>probe:Drosophila_2:1627497_at:716:535; Interrogation_Position=737; Antisense; GGTCCCAAGGATGTGAAGCTGTTCA
>probe:Drosophila_2:1627497_at:293:355; Interrogation_Position=774; Antisense; GCACGATTGACTTTGACATGGCCGA
>probe:Drosophila_2:1627497_at:621:581; Interrogation_Position=792; Antisense; TGGCCGAGTCCATGAACAGTGTGCA
>probe:Drosophila_2:1627497_at:64:521; Interrogation_Position=849; Antisense; GTGGAGTGCCCGTGAATCTGCGCTA
>probe:Drosophila_2:1627497_at:190:625; Interrogation_Position=867; Antisense; TGCGCTACGTCAAGTTCCAGAATGT
>probe:Drosophila_2:1627497_at:629:459; Interrogation_Position=950; Antisense; GATTATATCGGCTTCATCGGTTCCC
>probe:Drosophila_2:1627497_at:67:137; Interrogation_Position=996; Antisense; ACGACTTCAAGCGAGTGGCTGGCAA

Paste this into a BLAST search page for me
GGGCGAGAGCCACTAAGGTTCCATTTTTTCAGCGTTTTTCCCCAATGACGGTCCCAGCATTTCTTTTCAACTTTGGTGCGAGTGCCTCAACGAAGCTGATGCTACCTGCAGTCCGATTGCGATGAGTCCATCACCTTTAATCAGGCTGTGCAGGCTGTGAAGATCCACTCTTTGAGGTCCCAAGGATGTGAAGCTGTTCAGCACGATTGACTTTGACATGGCCGATGGCCGAGTCCATGAACAGTGTGCAGTGGAGTGCCCGTGAATCTGCGCTATGCGCTACGTCAAGTTCCAGAATGTGATTATATCGGCTTCATCGGTTCCCACGACTTCAAGCGAGTGGCTGGCAA

Full Affymetrix probeset data:

Annotations for 1627497_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720