Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627498_at:

>probe:Drosophila_2:1627498_at:416:111; Interrogation_Position=1752; Antisense; AGCAATCGCTTGCACTATTCGTACT
>probe:Drosophila_2:1627498_at:121:723; Interrogation_Position=1761; Antisense; TTGCACTATTCGTACTTATCCGGAC
>probe:Drosophila_2:1627498_at:324:695; Interrogation_Position=1776; Antisense; TTATCCGGACGATAGTGCGGCATCT
>probe:Drosophila_2:1627498_at:185:347; Interrogation_Position=1795; Antisense; GCATCTAAGGCATTGGGCATCGAGT
>probe:Drosophila_2:1627498_at:506:43; Interrogation_Position=1813; Antisense; ATCGAGTGGATGCAGCGATCCCAAC
>probe:Drosophila_2:1627498_at:558:673; Interrogation_Position=1863; Antisense; TACCAATCAACTCACCAACAGTAGC
>probe:Drosophila_2:1627498_at:657:185; Interrogation_Position=1879; Antisense; AACAGTAGCAATGCGGCCGTTAGCA
>probe:Drosophila_2:1627498_at:151:269; Interrogation_Position=1902; Antisense; CAGGCCGATACGAACATGCAGATAT
>probe:Drosophila_2:1627498_at:441:155; Interrogation_Position=1930; Antisense; ACAGCAAACTTAGCGAATGTCGTCA
>probe:Drosophila_2:1627498_at:134:489; Interrogation_Position=2056; Antisense; GTACTTTTTGTCATGATGCGGCGGC
>probe:Drosophila_2:1627498_at:697:605; Interrogation_Position=2069; Antisense; TGATGCGGCGGCAATTTTACTCCCT
>probe:Drosophila_2:1627498_at:434:279; Interrogation_Position=2092; Antisense; CTCTCTGTGCCGTAAACCTTTTATG
>probe:Drosophila_2:1627498_at:146:203; Interrogation_Position=2106; Antisense; AACCTTTTATGTGGTCAGCCGGGAG
>probe:Drosophila_2:1627498_at:43:439; Interrogation_Position=2128; Antisense; GAGGCGCAGCGTAGTTTTTGGCATA

Paste this into a BLAST search page for me
AGCAATCGCTTGCACTATTCGTACTTTGCACTATTCGTACTTATCCGGACTTATCCGGACGATAGTGCGGCATCTGCATCTAAGGCATTGGGCATCGAGTATCGAGTGGATGCAGCGATCCCAACTACCAATCAACTCACCAACAGTAGCAACAGTAGCAATGCGGCCGTTAGCACAGGCCGATACGAACATGCAGATATACAGCAAACTTAGCGAATGTCGTCAGTACTTTTTGTCATGATGCGGCGGCTGATGCGGCGGCAATTTTACTCCCTCTCTCTGTGCCGTAAACCTTTTATGAACCTTTTATGTGGTCAGCCGGGAGGAGGCGCAGCGTAGTTTTTGGCATA

Full Affymetrix probeset data:

Annotations for 1627498_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime