FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627499_at:

>probe:Drosophila_2:1627499_at:157:191; Interrogation_Position=324; Antisense; AACATTCAGGCCTACGGTGTGAGCA
>probe:Drosophila_2:1627499_at:417:243; Interrogation_Position=348; Antisense; AATATCACAGTGACCAACATCCGCT
>probe:Drosophila_2:1627499_at:342:351; Interrogation_Position=389; Antisense; GCAGTTCCAGCTGACGTGCGAGATA
>probe:Drosophila_2:1627499_at:154:87; Interrogation_Position=436; Antisense; AGTACCGGTCCACAGGTGTTCTGAT
>probe:Drosophila_2:1627499_at:710:641; Interrogation_Position=455; Antisense; TCTGATCTTGGTGAAGGCCTCCGGA
>probe:Drosophila_2:1627499_at:459:471; Interrogation_Position=510; Antisense; GTTAAGGCCAAGATCTACTTCAAGG
>probe:Drosophila_2:1627499_at:589:407; Interrogation_Position=575; Antisense; GACGGACTCCGTCAAGATGGACTTC
>probe:Drosophila_2:1627499_at:684:517; Interrogation_Position=622; Antisense; GTGTGGACAACATCGCCAATGGCAA
>probe:Drosophila_2:1627499_at:319:359; Interrogation_Position=643; Antisense; GCAACACAGTGATACAGGCTGCTCT
>probe:Drosophila_2:1627499_at:664:71; Interrogation_Position=658; Antisense; AGGCTGCTCTCAATCTGTTCATCAA
>probe:Drosophila_2:1627499_at:229:55; Interrogation_Position=711; Antisense; ATGAAGCCGGCGCTCAGGACCAAAC
>probe:Drosophila_2:1627499_at:321:591; Interrogation_Position=742; Antisense; TGGTCATCCGCAACTTCATGGATCG
>probe:Drosophila_2:1627499_at:650:599; Interrogation_Position=815; Antisense; TGTAGTTTCTCTAGTCTAAGACCTT
>probe:Drosophila_2:1627499_at:504:17; Interrogation_Position=840; Antisense; ATTTATTGCACACAGTTCCGCGAAA

Paste this into a BLAST search page for me
AACATTCAGGCCTACGGTGTGAGCAAATATCACAGTGACCAACATCCGCTGCAGTTCCAGCTGACGTGCGAGATAAGTACCGGTCCACAGGTGTTCTGATTCTGATCTTGGTGAAGGCCTCCGGAGTTAAGGCCAAGATCTACTTCAAGGGACGGACTCCGTCAAGATGGACTTCGTGTGGACAACATCGCCAATGGCAAGCAACACAGTGATACAGGCTGCTCTAGGCTGCTCTCAATCTGTTCATCAAATGAAGCCGGCGCTCAGGACCAAACTGGTCATCCGCAACTTCATGGATCGTGTAGTTTCTCTAGTCTAAGACCTTATTTATTGCACACAGTTCCGCGAAA

Full Affymetrix probeset data:

Annotations for 1627499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720