FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627500_at:

>probe:Drosophila_2:1627500_at:642:707; Interrogation_Position=1022; Antisense; TTAACGCGGCGAGGGTGGTCATTCA
>probe:Drosophila_2:1627500_at:662:221; Interrogation_Position=1046; Antisense; AAGTGGTTGGCAGTACCATCGCCAT
>probe:Drosophila_2:1627500_at:388:729; Interrogation_Position=1090; Antisense; TTGGGACTGTCCACCATCATGATGA
>probe:Drosophila_2:1627500_at:278:719; Interrogation_Position=1126; Antisense; TTCGCCTGTTGTGTTCTTGAGAGCA
>probe:Drosophila_2:1627500_at:417:725; Interrogation_Position=1142; Antisense; TTGAGAGCACGGTCAGAGCCACGGC
>probe:Drosophila_2:1627500_at:382:123; Interrogation_Position=1177; Antisense; AGCGAGATGTACTTGGCCCTCATGG
>probe:Drosophila_2:1627500_at:710:725; Interrogation_Position=1273; Antisense; TTGGGTAAAATCTTCTCGCTAACTA
>probe:Drosophila_2:1627500_at:326:685; Interrogation_Position=1339; Antisense; TATACGGCCGTGTACCAGGCAACAG
>probe:Drosophila_2:1627500_at:269:359; Interrogation_Position=1357; Antisense; GCAACAGTTAACTTCTATCCGGGAA
>probe:Drosophila_2:1627500_at:43:47; Interrogation_Position=1373; Antisense; ATCCGGGAATCTTCAACTTCATCAG
>probe:Drosophila_2:1627500_at:726:83; Interrogation_Position=1396; Antisense; AGTGTGGGACTGTACTTCCTGTGCT
>probe:Drosophila_2:1627500_at:48:189; Interrogation_Position=1468; Antisense; AACAGCGTTTACCAGGCCATAGGCA
>probe:Drosophila_2:1627500_at:720:57; Interrogation_Position=916; Antisense; ATGATGTCGCTGACACTGTGCGTTT
>probe:Drosophila_2:1627500_at:406:327; Interrogation_Position=987; Antisense; GCAGTTCGATTACACGGTCCAGGAC

Paste this into a BLAST search page for me
TTAACGCGGCGAGGGTGGTCATTCAAAGTGGTTGGCAGTACCATCGCCATTTGGGACTGTCCACCATCATGATGATTCGCCTGTTGTGTTCTTGAGAGCATTGAGAGCACGGTCAGAGCCACGGCAGCGAGATGTACTTGGCCCTCATGGTTGGGTAAAATCTTCTCGCTAACTATATACGGCCGTGTACCAGGCAACAGGCAACAGTTAACTTCTATCCGGGAAATCCGGGAATCTTCAACTTCATCAGAGTGTGGGACTGTACTTCCTGTGCTAACAGCGTTTACCAGGCCATAGGCAATGATGTCGCTGACACTGTGCGTTTGCAGTTCGATTACACGGTCCAGGAC

Full Affymetrix probeset data:

Annotations for 1627500_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720