Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627501_s_at:

>probe:Drosophila_2:1627501_s_at:645:409; Interrogation_Position=202; Antisense; GACGAAGTGTTAATCGACAAACAAC
>probe:Drosophila_2:1627501_s_at:374:357; Interrogation_Position=231; Antisense; GCAACAACGCCGGAGAAAACAACAT
>probe:Drosophila_2:1627501_s_at:723:385; Interrogation_Position=245; Antisense; GAAAACAACATGTGAGAGGCGGCTC
>probe:Drosophila_2:1627501_s_at:409:425; Interrogation_Position=258; Antisense; GAGAGGCGGCTCAAAAAGTTAATTT
>probe:Drosophila_2:1627501_s_at:385:87; Interrogation_Position=274; Antisense; AGTTAATTTAGCCAGTCGAAAAGAT
>probe:Drosophila_2:1627501_s_at:430:263; Interrogation_Position=286; Antisense; CAGTCGAAAAGATGGCCGCCAGGAT
>probe:Drosophila_2:1627501_s_at:280:69; Interrogation_Position=297; Antisense; ATGGCCGCCAGGATGTGCAGCATCG
>probe:Drosophila_2:1627501_s_at:315:77; Interrogation_Position=306; Antisense; AGGATGTGCAGCATCGCTTCCATCG
>probe:Drosophila_2:1627501_s_at:544:343; Interrogation_Position=321; Antisense; GCTTCCATCGTCATCATCTAGATTT
>probe:Drosophila_2:1627501_s_at:194:309; Interrogation_Position=325; Antisense; CCATCGTCATCATCTAGATTTTAGA
>probe:Drosophila_2:1627501_s_at:129:457; Interrogation_Position=381; Antisense; GATACACACGCATACCAATGCCGCT
>probe:Drosophila_2:1627501_s_at:681:233; Interrogation_Position=397; Antisense; AATGCCGCTGGCAGCCAGACACTCG
>probe:Drosophila_2:1627501_s_at:561:105; Interrogation_Position=413; Antisense; AGACACTCGCACACCAATACCAATG
>probe:Drosophila_2:1627501_s_at:482:669; Interrogation_Position=430; Antisense; TACCAATGCCAGTCCCTCTTAAAGG

Paste this into a BLAST search page for me
GACGAAGTGTTAATCGACAAACAACGCAACAACGCCGGAGAAAACAACATGAAAACAACATGTGAGAGGCGGCTCGAGAGGCGGCTCAAAAAGTTAATTTAGTTAATTTAGCCAGTCGAAAAGATCAGTCGAAAAGATGGCCGCCAGGATATGGCCGCCAGGATGTGCAGCATCGAGGATGTGCAGCATCGCTTCCATCGGCTTCCATCGTCATCATCTAGATTTCCATCGTCATCATCTAGATTTTAGAGATACACACGCATACCAATGCCGCTAATGCCGCTGGCAGCCAGACACTCGAGACACTCGCACACCAATACCAATGTACCAATGCCAGTCCCTCTTAAAGG

Full Affymetrix probeset data:

Annotations for 1627501_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime