Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627502_at:

>probe:Drosophila_2:1627502_at:223:529; Interrogation_Position=2034; Antisense; GGGTTGATATTTCCAATCTTTTCAC
>probe:Drosophila_2:1627502_at:301:257; Interrogation_Position=2056; Antisense; CACTAGTACTACTTTCTGGCCGAAA
>probe:Drosophila_2:1627502_at:415:285; Interrogation_Position=2071; Antisense; CTGGCCGAAAACGATATTCTGCTTT
>probe:Drosophila_2:1627502_at:117:695; Interrogation_Position=2109; Antisense; TTTGCTTAGCTATTTTGAGACACAG
>probe:Drosophila_2:1627502_at:623:423; Interrogation_Position=2125; Antisense; GAGACACAGCAAGTTTCCTAAAAAG
>probe:Drosophila_2:1627502_at:476:661; Interrogation_Position=2208; Antisense; TAACTGACTTTTGACTTGAGCTGAG
>probe:Drosophila_2:1627502_at:219:601; Interrogation_Position=2229; Antisense; TGAGTTTTTAAAATCGACCCACCAT
>probe:Drosophila_2:1627502_at:420:301; Interrogation_Position=2246; Antisense; CCCACCATTATCTCGACACAAATTT
>probe:Drosophila_2:1627502_at:239:361; Interrogation_Position=2327; Antisense; GCAAGAATGCACCAGAGATTGTTGT
>probe:Drosophila_2:1627502_at:582:707; Interrogation_Position=2394; Antisense; TTAACGCATAGGAGATCGATTCGAT
>probe:Drosophila_2:1627502_at:152:463; Interrogation_Position=2411; Antisense; GATTCGATACAATACGCTTCAGCAT
>probe:Drosophila_2:1627502_at:229:645; Interrogation_Position=2435; Antisense; TCATCATTTCGTTGCGGTAGTTTAT
>probe:Drosophila_2:1627502_at:590:253; Interrogation_Position=2479; Antisense; CAAACTACCGACTACCTACTAAGAT
>probe:Drosophila_2:1627502_at:142:387; Interrogation_Position=2529; Antisense; GAACAATCCAAACACACGAGCTAAA

Paste this into a BLAST search page for me
GGGTTGATATTTCCAATCTTTTCACCACTAGTACTACTTTCTGGCCGAAACTGGCCGAAAACGATATTCTGCTTTTTTGCTTAGCTATTTTGAGACACAGGAGACACAGCAAGTTTCCTAAAAAGTAACTGACTTTTGACTTGAGCTGAGTGAGTTTTTAAAATCGACCCACCATCCCACCATTATCTCGACACAAATTTGCAAGAATGCACCAGAGATTGTTGTTTAACGCATAGGAGATCGATTCGATGATTCGATACAATACGCTTCAGCATTCATCATTTCGTTGCGGTAGTTTATCAAACTACCGACTACCTACTAAGATGAACAATCCAAACACACGAGCTAAA

Full Affymetrix probeset data:

Annotations for 1627502_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime