FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627503_at:

>probe:Drosophila_2:1627503_at:457:439; Interrogation_Position=106; Antisense; GATGGTGGCCGAGAATGCCTACGAT
>probe:Drosophila_2:1627503_at:232:533; Interrogation_Position=109; Antisense; GGTGGCCGAGAATGCCTACGATCTT
>probe:Drosophila_2:1627503_at:500:319; Interrogation_Position=113; Antisense; GCCGAGAATGCCTACGATCTTGAGT
>probe:Drosophila_2:1627503_at:133:369; Interrogation_Position=118; Antisense; GAATGCCTACGATCTTGAGTCTCGA
>probe:Drosophila_2:1627503_at:345:315; Interrogation_Position=122; Antisense; GCCTACGATCTTGAGTCTCGAGTTT
>probe:Drosophila_2:1627503_at:465:451; Interrogation_Position=128; Antisense; GATCTTGAGTCTCGAGTTTACAACT
>probe:Drosophila_2:1627503_at:441:431; Interrogation_Position=134; Antisense; GAGTCTCGAGTTTACAACTCCAACT
>probe:Drosophila_2:1627503_at:21:73; Interrogation_Position=30; Antisense; AGGAAAAGCCCGCTGTGGCGTCCAG
>probe:Drosophila_2:1627503_at:122:629; Interrogation_Position=50; Antisense; TCCAGTTTCCCGTGGGATGAGTCCA
>probe:Drosophila_2:1627503_at:52:479; Interrogation_Position=54; Antisense; GTTTCCCGTGGGATGAGTCCAACAG
>probe:Drosophila_2:1627503_at:256:633; Interrogation_Position=57; Antisense; TCCCGTGGGATGAGTCCAACAGGAC
>probe:Drosophila_2:1627503_at:444:57; Interrogation_Position=66; Antisense; ATGAGTCCAACAGGACGGAGGACGA
>probe:Drosophila_2:1627503_at:135:151; Interrogation_Position=75; Antisense; ACAGGACGGAGGACGAGAAGCTAAC
>probe:Drosophila_2:1627503_at:665:373; Interrogation_Position=91; Antisense; GAAGCTAACGGCTTGGATGGTGGCC

Paste this into a BLAST search page for me
GATGGTGGCCGAGAATGCCTACGATGGTGGCCGAGAATGCCTACGATCTTGCCGAGAATGCCTACGATCTTGAGTGAATGCCTACGATCTTGAGTCTCGAGCCTACGATCTTGAGTCTCGAGTTTGATCTTGAGTCTCGAGTTTACAACTGAGTCTCGAGTTTACAACTCCAACTAGGAAAAGCCCGCTGTGGCGTCCAGTCCAGTTTCCCGTGGGATGAGTCCAGTTTCCCGTGGGATGAGTCCAACAGTCCCGTGGGATGAGTCCAACAGGACATGAGTCCAACAGGACGGAGGACGAACAGGACGGAGGACGAGAAGCTAACGAAGCTAACGGCTTGGATGGTGGCC

Full Affymetrix probeset data:

Annotations for 1627503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720