FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627504_at:

>probe:Drosophila_2:1627504_at:279:13; Interrogation_Position=112; Antisense; ATTATCTCGGCCCTAAATTGTCCGT
>probe:Drosophila_2:1627504_at:350:79; Interrogation_Position=131; Antisense; GTCCGTTCGACGAGGAATTTGCCTT
>probe:Drosophila_2:1627504_at:529:695; Interrogation_Position=158; Antisense; TTTCGTTTCAATCCCAAGATCAGTG
>probe:Drosophila_2:1627504_at:60:453; Interrogation_Position=175; Antisense; GATCAGTGGGATCCGACCGAATCAT
>probe:Drosophila_2:1627504_at:572:365; Interrogation_Position=193; Antisense; GAATCATGTCATCGCAGTTTCGTGA
>probe:Drosophila_2:1627504_at:567:323; Interrogation_Position=221; Antisense; GCGCGGATTAGCTAGCAGTGCCAAT
>probe:Drosophila_2:1627504_at:509:505; Interrogation_Position=238; Antisense; GTGCCAATAATGAACTGCCCACCAT
>probe:Drosophila_2:1627504_at:635:137; Interrogation_Position=271; Antisense; ACGAGAGTGACTTCGCTCTGGAGCT
>probe:Drosophila_2:1627504_at:620:557; Interrogation_Position=356; Antisense; GGACACCAACGTCTATCAGCGTGAG
>probe:Drosophila_2:1627504_at:389:395; Interrogation_Position=399; Antisense; GACAAGTCCTGGTCAGTCCTGTACT
>probe:Drosophila_2:1627504_at:642:87; Interrogation_Position=413; Antisense; AGTCCTGTACTTTGGATCCGGCAAG
>probe:Drosophila_2:1627504_at:191:293; Interrogation_Position=494; Antisense; CGTTCTGCGCCACTTTAAATCGAAT
>probe:Drosophila_2:1627504_at:101:697; Interrogation_Position=507; Antisense; TTTAAATCGAATGTCTGCCCACTGC
>probe:Drosophila_2:1627504_at:433:517; Interrogation_Position=58; Antisense; GTGTGTCAACTCTTTATTCAGGATA

Paste this into a BLAST search page for me
ATTATCTCGGCCCTAAATTGTCCGTGTCCGTTCGACGAGGAATTTGCCTTTTTCGTTTCAATCCCAAGATCAGTGGATCAGTGGGATCCGACCGAATCATGAATCATGTCATCGCAGTTTCGTGAGCGCGGATTAGCTAGCAGTGCCAATGTGCCAATAATGAACTGCCCACCATACGAGAGTGACTTCGCTCTGGAGCTGGACACCAACGTCTATCAGCGTGAGGACAAGTCCTGGTCAGTCCTGTACTAGTCCTGTACTTTGGATCCGGCAAGCGTTCTGCGCCACTTTAAATCGAATTTTAAATCGAATGTCTGCCCACTGCGTGTGTCAACTCTTTATTCAGGATA

Full Affymetrix probeset data:

Annotations for 1627504_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720