FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627505_at:

>probe:Drosophila_2:1627505_at:29:603; Interrogation_Position=170; Antisense; TGTTCTTCCACCAGCAATCCTGTGA
>probe:Drosophila_2:1627505_at:518:359; Interrogation_Position=291; Antisense; GCAAGCAGAGAATCCTCCGGCAGGA
>probe:Drosophila_2:1627505_at:350:499; Interrogation_Position=334; Antisense; GTCGTAGACGATGGCGGACCTGCTC
>probe:Drosophila_2:1627505_at:538:79; Interrogation_Position=369; Antisense; AGGTGCTTCGGTTGCCACACAAGTT
>probe:Drosophila_2:1627505_at:353:469; Interrogation_Position=379; Antisense; GTTGCCACACAAGTTTCACCAGGAG
>probe:Drosophila_2:1627505_at:401:79; Interrogation_Position=438; Antisense; AGGTCTTCCCGTGGATGATGTTCAT
>probe:Drosophila_2:1627505_at:490:443; Interrogation_Position=454; Antisense; GATGTTCATGTTGAACGCTCTCCCA
>probe:Drosophila_2:1627505_at:234:293; Interrogation_Position=486; Antisense; CGATGTGGACTTTCCGGGCCAGGCT
>probe:Drosophila_2:1627505_at:593:465; Interrogation_Position=511; Antisense; GTTGTCTACATCCTCGTGGGAATCA
>probe:Drosophila_2:1627505_at:120:519; Interrogation_Position=526; Antisense; GTGGGAATCACCAGTACTGCAATAC
>probe:Drosophila_2:1627505_at:419:29; Interrogation_Position=547; Antisense; ATACTGCTGCTTATTATGAGGGTTT
>probe:Drosophila_2:1627505_at:567:607; Interrogation_Position=563; Antisense; TGAGGGTTTATAGGCTCCGACTTTC
>probe:Drosophila_2:1627505_at:159:213; Interrogation_Position=680; Antisense; AAGAGGACCACACCCTGTTCGAGGT
>probe:Drosophila_2:1627505_at:126:539; Interrogation_Position=702; Antisense; GGTCAATCGCCAGAACATACGCATA

Paste this into a BLAST search page for me
TGTTCTTCCACCAGCAATCCTGTGAGCAAGCAGAGAATCCTCCGGCAGGAGTCGTAGACGATGGCGGACCTGCTCAGGTGCTTCGGTTGCCACACAAGTTGTTGCCACACAAGTTTCACCAGGAGAGGTCTTCCCGTGGATGATGTTCATGATGTTCATGTTGAACGCTCTCCCACGATGTGGACTTTCCGGGCCAGGCTGTTGTCTACATCCTCGTGGGAATCAGTGGGAATCACCAGTACTGCAATACATACTGCTGCTTATTATGAGGGTTTTGAGGGTTTATAGGCTCCGACTTTCAAGAGGACCACACCCTGTTCGAGGTGGTCAATCGCCAGAACATACGCATA

Full Affymetrix probeset data:

Annotations for 1627505_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720