FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627506_at:

>probe:Drosophila_2:1627506_at:90:1; Interrogation_Position=5286; Antisense; AAAAGAAACCGGCTCCTCCATTCTG
>probe:Drosophila_2:1627506_at:673:569; Interrogation_Position=5296; Antisense; GGCTCCTCCATTCTGAAAACTTTAA
>probe:Drosophila_2:1627506_at:406:57; Interrogation_Position=5334; Antisense; ATGTACCAACTAACGAAACTATTTG
>probe:Drosophila_2:1627506_at:51:21; Interrogation_Position=5354; Antisense; ATTTGTTCTGTTTTCCATTTGTTCG
>probe:Drosophila_2:1627506_at:426:307; Interrogation_Position=5368; Antisense; CCATTTGTTCGAACTTTGTGTTGAA
>probe:Drosophila_2:1627506_at:480:723; Interrogation_Position=5407; Antisense; TTGTAATTATCTTTAGGTCGACTAG
>probe:Drosophila_2:1627506_at:702:475; Interrogation_Position=5459; Antisense; GTTTTGTTTGTGCATTACGTTGTGT
>probe:Drosophila_2:1627506_at:393:291; Interrogation_Position=5476; Antisense; CGTTGTGTTTTTAACCCTTATCATG
>probe:Drosophila_2:1627506_at:210:127; Interrogation_Position=5489; Antisense; ACCCTTATCATGTGTTTTGCAACTT
>probe:Drosophila_2:1627506_at:632:645; Interrogation_Position=5496; Antisense; TCATGTGTTTTGCAACTTTTTGACA
>probe:Drosophila_2:1627506_at:250:147; Interrogation_Position=5510; Antisense; ACTTTTTGACAATGGCACAGACACA
>probe:Drosophila_2:1627506_at:323:375; Interrogation_Position=5541; Antisense; GAAGATCGAGAGAACAACATTTTAT
>probe:Drosophila_2:1627506_at:630:481; Interrogation_Position=5601; Antisense; GTATATATTTACTTGACTTGCAAAG
>probe:Drosophila_2:1627506_at:164:353; Interrogation_Position=5633; Antisense; GCAGCAGCGGCAACTTAAATTAAAT

Paste this into a BLAST search page for me
AAAAGAAACCGGCTCCTCCATTCTGGGCTCCTCCATTCTGAAAACTTTAAATGTACCAACTAACGAAACTATTTGATTTGTTCTGTTTTCCATTTGTTCGCCATTTGTTCGAACTTTGTGTTGAATTGTAATTATCTTTAGGTCGACTAGGTTTTGTTTGTGCATTACGTTGTGTCGTTGTGTTTTTAACCCTTATCATGACCCTTATCATGTGTTTTGCAACTTTCATGTGTTTTGCAACTTTTTGACAACTTTTTGACAATGGCACAGACACAGAAGATCGAGAGAACAACATTTTATGTATATATTTACTTGACTTGCAAAGGCAGCAGCGGCAACTTAAATTAAAT

Full Affymetrix probeset data:

Annotations for 1627506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720