FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627507_at:

>probe:Drosophila_2:1627507_at:418:189; Interrogation_Position=1016; Antisense; AACATCACAGACCTCCTGCTATGAC
>probe:Drosophila_2:1627507_at:117:57; Interrogation_Position=1036; Antisense; ATGACCTCCTGGACTGTGGCCGGAA
>probe:Drosophila_2:1627507_at:87:205; Interrogation_Position=1084; Antisense; AAGCGATTTTTCACATGGACCAACA
>probe:Drosophila_2:1627507_at:304:281; Interrogation_Position=618; Antisense; CTCCTACACGCACAACCAATTGGGA
>probe:Drosophila_2:1627507_at:110:619; Interrogation_Position=647; Antisense; TGCTGGCTGCGGGAAGCTTTAATTC
>probe:Drosophila_2:1627507_at:619:725; Interrogation_Position=712; Antisense; TTGGCCAAGTCGAAACTGTATCCCG
>probe:Drosophila_2:1627507_at:354:1; Interrogation_Position=732; Antisense; TCCCGAACGGTTCTATTTCACTAGG
>probe:Drosophila_2:1627507_at:610:271; Interrogation_Position=839; Antisense; CATATCTAATCATCAAGGGCTCCTT
>probe:Drosophila_2:1627507_at:224:221; Interrogation_Position=853; Antisense; AAGGGCTCCTTGTCACCATATCTCT
>probe:Drosophila_2:1627507_at:728:629; Interrogation_Position=877; Antisense; TCCGTCCGCAACAACGAGGCTATAT
>probe:Drosophila_2:1627507_at:429:461; Interrogation_Position=903; Antisense; GATTTTGGCCAAGGATAATCCGCAC
>probe:Drosophila_2:1627507_at:636:285; Interrogation_Position=939; Antisense; CGAGGTGGAAAACGGCACCCATCAT
>probe:Drosophila_2:1627507_at:204:73; Interrogation_Position=983; Antisense; AGGAATGCGCCGGTTACATTGTGCC
>probe:Drosophila_2:1627507_at:409:709; Interrogation_Position=996; Antisense; TTACATTGTGCCCTTCATCCAACAT

Paste this into a BLAST search page for me
AACATCACAGACCTCCTGCTATGACATGACCTCCTGGACTGTGGCCGGAAAAGCGATTTTTCACATGGACCAACACTCCTACACGCACAACCAATTGGGATGCTGGCTGCGGGAAGCTTTAATTCTTGGCCAAGTCGAAACTGTATCCCGTCCCGAACGGTTCTATTTCACTAGGCATATCTAATCATCAAGGGCTCCTTAAGGGCTCCTTGTCACCATATCTCTTCCGTCCGCAACAACGAGGCTATATGATTTTGGCCAAGGATAATCCGCACCGAGGTGGAAAACGGCACCCATCATAGGAATGCGCCGGTTACATTGTGCCTTACATTGTGCCCTTCATCCAACAT

Full Affymetrix probeset data:

Annotations for 1627507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720