FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627510_at:

>probe:Drosophila_2:1627510_at:281:711; Interrogation_Position=108; Antisense; TTCAATCATCCAGATCGAGGTCATT
>probe:Drosophila_2:1627510_at:198:583; Interrogation_Position=132; Antisense; TGGCGAGGTGGCCTATCCTTGTTAT
>probe:Drosophila_2:1627510_at:499:305; Interrogation_Position=143; Antisense; CCTATCCTTGTTATCTGTGCACCAA
>probe:Drosophila_2:1627510_at:670:363; Interrogation_Position=168; Antisense; GAATTTAATCAGAAACGACGCCTTG
>probe:Drosophila_2:1627510_at:502:309; Interrogation_Position=18; Antisense; CCACTGGATTGGAGGCTTATGGCCT
>probe:Drosophila_2:1627510_at:695:367; Interrogation_Position=192; Antisense; GAATGTGCACATTGGCACCGGCAAG
>probe:Drosophila_2:1627510_at:260:3; Interrogation_Position=202; Antisense; ATTGGCACCGGCAAGTCTGACATCC
>probe:Drosophila_2:1627510_at:693:611; Interrogation_Position=219; Antisense; TGACATCCGCCACCGAGAAGGAAAG
>probe:Drosophila_2:1627510_at:176:561; Interrogation_Position=238; Antisense; GGAAAGGATCGAGCCACCAATGTGC
>probe:Drosophila_2:1627510_at:669:293; Interrogation_Position=247; Antisense; CGAGCCACCAATGTGCACCTGATAA
>probe:Drosophila_2:1627510_at:6:71; Interrogation_Position=30; Antisense; AGGCTTATGGCCTCAGGCGCATACG
>probe:Drosophila_2:1627510_at:325:317; Interrogation_Position=313; Antisense; GCGCTAGAATGCATAGCAACTCGGT
>probe:Drosophila_2:1627510_at:723:611; Interrogation_Position=72; Antisense; TGACACGCTGCAAAAGTCCCTGAGT
>probe:Drosophila_2:1627510_at:533:503; Interrogation_Position=87; Antisense; GTCCCTGAGTGAGGCCAATAATTCA

Paste this into a BLAST search page for me
TTCAATCATCCAGATCGAGGTCATTTGGCGAGGTGGCCTATCCTTGTTATCCTATCCTTGTTATCTGTGCACCAAGAATTTAATCAGAAACGACGCCTTGCCACTGGATTGGAGGCTTATGGCCTGAATGTGCACATTGGCACCGGCAAGATTGGCACCGGCAAGTCTGACATCCTGACATCCGCCACCGAGAAGGAAAGGGAAAGGATCGAGCCACCAATGTGCCGAGCCACCAATGTGCACCTGATAAAGGCTTATGGCCTCAGGCGCATACGGCGCTAGAATGCATAGCAACTCGGTTGACACGCTGCAAAAGTCCCTGAGTGTCCCTGAGTGAGGCCAATAATTCA

Full Affymetrix probeset data:

Annotations for 1627510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720