FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627511_at:

>probe:Drosophila_2:1627511_at:483:15; Interrogation_Position=3184; Antisense; ATATTTGATGTGTTTCTAATGTAAG
>probe:Drosophila_2:1627511_at:172:235; Interrogation_Position=3262; Antisense; AATCCAGCCGATTTCATTCGATGTG
>probe:Drosophila_2:1627511_at:274:461; Interrogation_Position=3271; Antisense; GATTTCATTCGATGTGCGTAGCTGT
>probe:Drosophila_2:1627511_at:241:11; Interrogation_Position=3277; Antisense; ATTCGATGTGCGTAGCTGTGTGTTT
>probe:Drosophila_2:1627511_at:555:507; Interrogation_Position=3284; Antisense; GTGCGTAGCTGTGTGTTTATCTGTA
>probe:Drosophila_2:1627511_at:278:487; Interrogation_Position=3288; Antisense; GTAGCTGTGTGTTTATCTGTAGATT
>probe:Drosophila_2:1627511_at:266:427; Interrogation_Position=3397; Antisense; GATGATTATCGATAGAAAGCGGTAA
>probe:Drosophila_2:1627511_at:508:241; Interrogation_Position=3448; Antisense; AATACATTTTGGCTAGTTAGTTGGC
>probe:Drosophila_2:1627511_at:120:463; Interrogation_Position=3487; Antisense; GATTAATGAATGATCTAAGCAGTAA
>probe:Drosophila_2:1627511_at:545:659; Interrogation_Position=3560; Antisense; TAACTATTGTGAAGAGGCAGGAGCA
>probe:Drosophila_2:1627511_at:397:561; Interrogation_Position=3594; Antisense; GGAAAATATAAAGTCATCTGTGTTA
>probe:Drosophila_2:1627511_at:224:1; Interrogation_Position=3637; Antisense; TTTAGCGTAGAATAACAAAACCAAG
>probe:Drosophila_2:1627511_at:38:189; Interrogation_Position=3709; Antisense; AACAGATCTCTAAAAGCTCTCACAT
>probe:Drosophila_2:1627511_at:543:183; Interrogation_Position=3720; Antisense; AAAAGCTCTCACATAAGCCACAAAA

Paste this into a BLAST search page for me
ATATTTGATGTGTTTCTAATGTAAGAATCCAGCCGATTTCATTCGATGTGGATTTCATTCGATGTGCGTAGCTGTATTCGATGTGCGTAGCTGTGTGTTTGTGCGTAGCTGTGTGTTTATCTGTAGTAGCTGTGTGTTTATCTGTAGATTGATGATTATCGATAGAAAGCGGTAAAATACATTTTGGCTAGTTAGTTGGCGATTAATGAATGATCTAAGCAGTAATAACTATTGTGAAGAGGCAGGAGCAGGAAAATATAAAGTCATCTGTGTTATTTAGCGTAGAATAACAAAACCAAGAACAGATCTCTAAAAGCTCTCACATAAAAGCTCTCACATAAGCCACAAAA

Full Affymetrix probeset data:

Annotations for 1627511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720