Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627512_at:

>probe:Drosophila_2:1627512_at:439:425; Interrogation_Position=1926; Antisense; GAGAGCAGGTTTTCGACCATGAGCA
>probe:Drosophila_2:1627512_at:154:349; Interrogation_Position=1948; Antisense; GCAGGAATTCAAGCTCAATCCGGAA
>probe:Drosophila_2:1627512_at:557:653; Interrogation_Position=1962; Antisense; TCAATCCGGAACTCAAGCTGGGCGA
>probe:Drosophila_2:1627512_at:596:425; Interrogation_Position=1985; Antisense; GAGAGCTTGTCCAAGAGCCACCAGG
>probe:Drosophila_2:1627512_at:409:415; Interrogation_Position=1999; Antisense; GAGCCACCAGGAACTGTAGATTTCT
>probe:Drosophila_2:1627512_at:47:677; Interrogation_Position=2064; Antisense; TAGTACTAGCCTAACAACTGCCAAA
>probe:Drosophila_2:1627512_at:152:249; Interrogation_Position=2078; Antisense; CAACTGCCAAATGTGCCTTTAATCC
>probe:Drosophila_2:1627512_at:391:505; Interrogation_Position=2090; Antisense; GTGCCTTTAATCCAAATCCACCAAA
>probe:Drosophila_2:1627512_at:702:473; Interrogation_Position=2142; Antisense; GTTAATGTTTTGATTAGCCGACCTA
>probe:Drosophila_2:1627512_at:594:125; Interrogation_Position=2157; Antisense; AGCCGACCTAATATTTTGTGCAATT
>probe:Drosophila_2:1627512_at:629:727; Interrogation_Position=2336; Antisense; TTGGAATACACGTACGCACCTCAAA
>probe:Drosophila_2:1627512_at:407:153; Interrogation_Position=2433; Antisense; ACATGCCATTGTCGTAGCCATTAAG
>probe:Drosophila_2:1627512_at:661:661; Interrogation_Position=2476; Antisense; TAAACTCTCTGACTTTATTCCGCTC
>probe:Drosophila_2:1627512_at:717:689; Interrogation_Position=2491; Antisense; TATTCCGCTCACAAGTGATGTGCAA

Paste this into a BLAST search page for me
GAGAGCAGGTTTTCGACCATGAGCAGCAGGAATTCAAGCTCAATCCGGAATCAATCCGGAACTCAAGCTGGGCGAGAGAGCTTGTCCAAGAGCCACCAGGGAGCCACCAGGAACTGTAGATTTCTTAGTACTAGCCTAACAACTGCCAAACAACTGCCAAATGTGCCTTTAATCCGTGCCTTTAATCCAAATCCACCAAAGTTAATGTTTTGATTAGCCGACCTAAGCCGACCTAATATTTTGTGCAATTTTGGAATACACGTACGCACCTCAAAACATGCCATTGTCGTAGCCATTAAGTAAACTCTCTGACTTTATTCCGCTCTATTCCGCTCACAAGTGATGTGCAA

Full Affymetrix probeset data:

Annotations for 1627512_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime