FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627515_at:

>probe:Drosophila_2:1627515_at:412:541; Interrogation_Position=1041; Antisense; GGTTCGCCCTTAGTCTAGCGAGTAA
>probe:Drosophila_2:1627515_at:28:675; Interrogation_Position=1056; Antisense; TAGCGAGTAATTATCTGGCGTAGGT
>probe:Drosophila_2:1627515_at:160:437; Interrogation_Position=1111; Antisense; GAGGATACGCTTCGTACAAGCATTT
>probe:Drosophila_2:1627515_at:589:343; Interrogation_Position=1130; Antisense; GCATTTTTCAAGCATCACATACTCT
>probe:Drosophila_2:1627515_at:461:687; Interrogation_Position=1158; Antisense; TATATTCATACTTATCGCCCCATAC
>probe:Drosophila_2:1627515_at:281:31; Interrogation_Position=1185; Antisense; ATAAAAACTCGATTTGCTGGCAAAA
>probe:Drosophila_2:1627515_at:444:403; Interrogation_Position=1237; Antisense; GACTAATGTTTGTTTTGGATCTTTG
>probe:Drosophila_2:1627515_at:283:545; Interrogation_Position=1253; Antisense; GGATCTTTGAAGTACCCATCACAAC
>probe:Drosophila_2:1627515_at:2:663; Interrogation_Position=1325; Antisense; TAAAACCAACCAAACTGAGCCACTC
>probe:Drosophila_2:1627515_at:546:609; Interrogation_Position=1340; Antisense; TGAGCCACTCTAGCCAGGGACATAT
>probe:Drosophila_2:1627515_at:470:279; Interrogation_Position=1452; Antisense; CTACTTTATTGTTTGGTGTTGCGCA
>probe:Drosophila_2:1627515_at:167:465; Interrogation_Position=1487; Antisense; GTTGAATTACGTTTATCCTTGAGGG
>probe:Drosophila_2:1627515_at:305:435; Interrogation_Position=1507; Antisense; GAGGGTTCTCCAAAATGTATGCTTT
>probe:Drosophila_2:1627515_at:343:315; Interrogation_Position=1558; Antisense; GCCATTTTTATGTTCTTCGTTTTAG

Paste this into a BLAST search page for me
GGTTCGCCCTTAGTCTAGCGAGTAATAGCGAGTAATTATCTGGCGTAGGTGAGGATACGCTTCGTACAAGCATTTGCATTTTTCAAGCATCACATACTCTTATATTCATACTTATCGCCCCATACATAAAAACTCGATTTGCTGGCAAAAGACTAATGTTTGTTTTGGATCTTTGGGATCTTTGAAGTACCCATCACAACTAAAACCAACCAAACTGAGCCACTCTGAGCCACTCTAGCCAGGGACATATCTACTTTATTGTTTGGTGTTGCGCAGTTGAATTACGTTTATCCTTGAGGGGAGGGTTCTCCAAAATGTATGCTTTGCCATTTTTATGTTCTTCGTTTTAG

Full Affymetrix probeset data:

Annotations for 1627515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720