FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627516_at:

>probe:Drosophila_2:1627516_at:52:227; Interrogation_Position=2357; Antisense; AAGGAAACCTATTTGCTGGATCACC
>probe:Drosophila_2:1627516_at:541:373; Interrogation_Position=2389; Antisense; GAAGTACGGCAATCCGGCTCAGGAT
>probe:Drosophila_2:1627516_at:498:571; Interrogation_Position=2404; Antisense; GGCTCAGGATCTTTACTACTTCCTA
>probe:Drosophila_2:1627516_at:670:667; Interrogation_Position=2417; Antisense; TACTACTTCCTAATCAGTTCTGCGG
>probe:Drosophila_2:1627516_at:519:719; Interrogation_Position=2466; Antisense; TTGACAATCTTATCCGCTTTTACCA
>probe:Drosophila_2:1627516_at:469:139; Interrogation_Position=2529; Antisense; ACGGATTCGTGCCTTCACTAAGTGA
>probe:Drosophila_2:1627516_at:504:723; Interrogation_Position=2567; Antisense; TTGATAGAGCATCCGGCATTCGCTG
>probe:Drosophila_2:1627516_at:161:501; Interrogation_Position=2591; Antisense; GTCGGCACAGTCATCAGCACACTAA
>probe:Drosophila_2:1627516_at:574:195; Interrogation_Position=2614; Antisense; AACTGTTTGCCTAACCGATGAAGGT
>probe:Drosophila_2:1627516_at:346:245; Interrogation_Position=2649; Antisense; AATTATTCTTTGTCGAGACGCCGGA
>probe:Drosophila_2:1627516_at:75:1; Interrogation_Position=2664; Antisense; AGACGCCGGAATCCGAAGCCTTTAG
>probe:Drosophila_2:1627516_at:681:177; Interrogation_Position=2693; Antisense; AAACTTCTTGGCAACGAGCGTTACA
>probe:Drosophila_2:1627516_at:729:407; Interrogation_Position=2708; Antisense; GAGCGTTACAAAGCCCACGTGGAAA
>probe:Drosophila_2:1627516_at:74:537; Interrogation_Position=2759; Antisense; GGTCTCCTCGATCCTTGAAGGAGTT

Paste this into a BLAST search page for me
AAGGAAACCTATTTGCTGGATCACCGAAGTACGGCAATCCGGCTCAGGATGGCTCAGGATCTTTACTACTTCCTATACTACTTCCTAATCAGTTCTGCGGTTGACAATCTTATCCGCTTTTACCAACGGATTCGTGCCTTCACTAAGTGATTGATAGAGCATCCGGCATTCGCTGGTCGGCACAGTCATCAGCACACTAAAACTGTTTGCCTAACCGATGAAGGTAATTATTCTTTGTCGAGACGCCGGAAGACGCCGGAATCCGAAGCCTTTAGAAACTTCTTGGCAACGAGCGTTACAGAGCGTTACAAAGCCCACGTGGAAAGGTCTCCTCGATCCTTGAAGGAGTT

Full Affymetrix probeset data:

Annotations for 1627516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720