FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627518_at:

>probe:Drosophila_2:1627518_at:91:555; Interrogation_Position=351; Antisense; GGAGCGAATTGTGTCCGCCGGCCTA
>probe:Drosophila_2:1627518_at:309:27; Interrogation_Position=400; Antisense; ATAGCTCCATCCCAGGTATTGGACG
>probe:Drosophila_2:1627518_at:568:539; Interrogation_Position=477; Antisense; GGTAGTTGACTACATGCGGCCATCT
>probe:Drosophila_2:1627518_at:49:53; Interrogation_Position=490; Antisense; ATGCGGCCATCTGTCGTTGGAAACG
>probe:Drosophila_2:1627518_at:651:207; Interrogation_Position=505; Antisense; GTTGGAAACGTCCTGCCCAAGGTAG
>probe:Drosophila_2:1627518_at:283:223; Interrogation_Position=523; Antisense; AAGGTAGCCCACATTGCGCTGATCA
>probe:Drosophila_2:1627518_at:205:323; Interrogation_Position=538; Antisense; GCGCTGATCATCATCTCGGTGGCCA
>probe:Drosophila_2:1627518_at:544:315; Interrogation_Position=572; Antisense; GCCTCTTCTACTTCATCCAAAATGA
>probe:Drosophila_2:1627518_at:419:641; Interrogation_Position=603; Antisense; TCTGGCCAATGGTATCAAGCGCTTC
>probe:Drosophila_2:1627518_at:291:685; Interrogation_Position=615; Antisense; TATCAAGCGCTTCTGGGCCATCAAG
>probe:Drosophila_2:1627518_at:454:89; Interrogation_Position=753; Antisense; AGTCACAGCTGCACAGAGCGGGTTT
>probe:Drosophila_2:1627518_at:30:457; Interrogation_Position=818; Antisense; GTAGTTGGGTAACAGGCACCACCTT
>probe:Drosophila_2:1627518_at:2:547; Interrogation_Position=832; Antisense; GGCACCACCTTTGTTACGTATGGTA
>probe:Drosophila_2:1627518_at:237:691; Interrogation_Position=876; Antisense; TTTGGGCTATTGTCCAGGTTTGGTC

Paste this into a BLAST search page for me
GGAGCGAATTGTGTCCGCCGGCCTAATAGCTCCATCCCAGGTATTGGACGGGTAGTTGACTACATGCGGCCATCTATGCGGCCATCTGTCGTTGGAAACGGTTGGAAACGTCCTGCCCAAGGTAGAAGGTAGCCCACATTGCGCTGATCAGCGCTGATCATCATCTCGGTGGCCAGCCTCTTCTACTTCATCCAAAATGATCTGGCCAATGGTATCAAGCGCTTCTATCAAGCGCTTCTGGGCCATCAAGAGTCACAGCTGCACAGAGCGGGTTTGTAGTTGGGTAACAGGCACCACCTTGGCACCACCTTTGTTACGTATGGTATTTGGGCTATTGTCCAGGTTTGGTC

Full Affymetrix probeset data:

Annotations for 1627518_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720