FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627528_at:

>probe:Drosophila_2:1627528_at:512:85; Interrogation_Position=1195; Antisense; AGTGCCTATACCCAATTCCTGAAGC
>probe:Drosophila_2:1627528_at:616:613; Interrogation_Position=1214; Antisense; TGAAGCCCGTGCACTTGTTAGACGA
>probe:Drosophila_2:1627528_at:539:327; Interrogation_Position=1243; Antisense; GCGTTAAAGGCCCAACTGACTCATA
>probe:Drosophila_2:1627528_at:81:99; Interrogation_Position=1296; Antisense; AGATGATTTCGATACCGCCAGAGCC
>probe:Drosophila_2:1627528_at:568:415; Interrogation_Position=1316; Antisense; GAGCCATCAGCGTGCTAATCGATCA
>probe:Drosophila_2:1627528_at:175:279; Interrogation_Position=1401; Antisense; CTACTGCATTGATCTGCTGTTGGCA
>probe:Drosophila_2:1627528_at:352:561; Interrogation_Position=1429; Antisense; GGAAACTTCATAAACCGTGCCATAG
>probe:Drosophila_2:1627528_at:696:505; Interrogation_Position=1445; Antisense; GTGCCATAGTCACGTTTGGTCTATC
>probe:Drosophila_2:1627528_at:131:345; Interrogation_Position=1523; Antisense; GCATTGATCCCAATTTGCTTGTGAA
>probe:Drosophila_2:1627528_at:163:1; Interrogation_Position=1600; Antisense; GTTAAGAACCCGCAGCTTTTAGCCG
>probe:Drosophila_2:1627528_at:277:275; Interrogation_Position=1615; Antisense; CTTTTAGCCGCCTGTGATGAACTGA
>probe:Drosophila_2:1627528_at:614:473; Interrogation_Position=1647; Antisense; GTTACAACAGCACGGCATTCAGGTC
>probe:Drosophila_2:1627528_at:149:179; Interrogation_Position=1681; Antisense; AAACAGGGCAGCTCCTGGGTGTTTG
>probe:Drosophila_2:1627528_at:314:515; Interrogation_Position=1699; Antisense; GTGTTTGCCGTGTCCTGTGAAAAGC

Paste this into a BLAST search page for me
AGTGCCTATACCCAATTCCTGAAGCTGAAGCCCGTGCACTTGTTAGACGAGCGTTAAAGGCCCAACTGACTCATAAGATGATTTCGATACCGCCAGAGCCGAGCCATCAGCGTGCTAATCGATCACTACTGCATTGATCTGCTGTTGGCAGGAAACTTCATAAACCGTGCCATAGGTGCCATAGTCACGTTTGGTCTATCGCATTGATCCCAATTTGCTTGTGAAGTTAAGAACCCGCAGCTTTTAGCCGCTTTTAGCCGCCTGTGATGAACTGAGTTACAACAGCACGGCATTCAGGTCAAACAGGGCAGCTCCTGGGTGTTTGGTGTTTGCCGTGTCCTGTGAAAAGC

Full Affymetrix probeset data:

Annotations for 1627528_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720